Brs3 (NM_152845) Rat Untagged Clone

CAT#: RN209450

Reviews ()
Write a review

Brs3 (untagged ORF) - Rat bombesin-like receptor 3 (Brs3), (10 ug)



  "NM_152845" in other vectors (3)

USD 420.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Brs3 (NM_152845) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Brs3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN209450 representing NM_152845
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCAAAGGCAGCCTCAGTCACCTAATCAGACTTTAATTTCCATTACAAATGACACAGAAACATCAA
GCTCTGCCGTCTCCAACGATACTACACCTAAAGGATGGACCGGAGACAACTCTCCAGGAATAGAAGCACT
GTGTGCCATCTATATCACTTATGCTGTGATCATTTCAGTGGGCATCCTCGGAAATGCTATCCTCATCAAA
GTCTTTTTCAAGACTAAATCCATGCAAACAGTTCCAAATATTTTCATCACCAGCCTGGCTTTTGGAGATC
TGTTACTCCTGCTGACTTGTGTGCCAGTGGATGCAACCCACTACCTGGCAGAGGGATGGCTGTTTGGAAA
GGTCGGTTGTAAAGTGCTTTCCTTCATCCGGCTCACTTCTGTCGGTGTATCAGTGTTCACGCTGACAATT
CTCAGCGCTGACAGATACAAAGCAGTCGTGAAGCCACTTGAACGACAGCCCTCCAATGCCATTCTGAAGA
CCTGTGCCAAAGCTGGTGGCATCTGGATCATGGCTATGATATTTGCTCTGCCAGAGGCTATATTCTCAAA
TGTATACACTTTCCAAGATCCTAACAGAAACGTAACATTTGAATCCTGTAACTCCTACCCTATCTCTGAG
AGGCTTTTGCAGGAAATACATTCTCTGTTGTGTTTCTTGGTGTTCTACATTATCCCGCTCTCGATTATCT
CTGTCTATTATTCTTTGATTGCCAGGACTCTTTACAAAAGCACCTTGAACATACCGACTGAGGAACAAAG
CCATGCCCGAAAGCAGATTGAATCCCGGAAGAGAATTGCCAAAACGGTACTGGTGCTGGTGGCTCTGTTC
GCACTCTGCTGGTTGCCGAATCACCTCCTGTATCTCTATCACTCATTCACTTATGAAAGCTACGCAGAGC
CTTCTGATGTCCCTTTCGTTGTCACCATTTTCTCTCGGGTGCTGGCTTTCAGTAATTCCTGCGTGAACCC
CTTTGCTCTGTATTGGCTGAGCAAGACCTTCCAGAAGCATTTTAAGGCTCAGCTCTGCTGCTTCAAGGCA
GAGCAGCCTGAACCTCCTCTTGGTGACACCCCCCTTAACAACCTCACTGTGATGGGGCGGGTTCCAGCTA
CTGGGAGTGCACACGTCTCTGAAATTAGCGTGACCCTGTTTAGTGGCAGTACTGCCAAGAAAGGAGAGGA
CAAAGTTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_152845
Insert Size 1200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_152845.1, NP_690058.1
RefSeq Size 1380 bp
RefSeq ORF 1200 bp
Locus ID 260319
Cytogenetics Xq37
Gene Summary weakly activated by agonist dY-bombesin [RGD, Feb 2006]

Citations (1)

Other Versions

Other products for "Brs3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools