Calml3 (NM_001012054) Rat Untagged Clone

USD 410.00


Availability*
2 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Calml3 (NM_001012054) Rat Untagged Clone
Type Rat Untagged Clone
Tag Tag Free
Symbol Calml3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>RN208868 representing NM_001012054
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAACCAGCTGACTGAGGAGCAAATCGCCGAGTTCAAGGAGGCTTTCTCTCTGTTTGACAAGGATG
GGGATGGCTGCATCACCACCCAAGAACTGGGCACTGTCATGAGGTCCCTGGGTCAGAACCCCACAGAGGC
TGAGCTCCAAGACATGGTGAACGAAATCGACAAGGATGGAAACGGCACCGTGGACTTCCCCGAGTTCCTG
ACCATGATGTCCAGGAAGATGAAAGACACCGACAGCGAGGAGGAGATCCGGGAGGCCTTCCGGGTGTTTG
ACAAGGACGGCAACGGCTTCGTCAGCGCAGCTGAGCTGAGGCACGTGATGACCAGGCTTGGGGAGAAGCT
GAGCGACGAGGAGGTAGATGAAATGATACAGGCGGCGGATACAGACGGCGACGGGCAAGTGAACTATGAG
GAATTTGTTCACATGCTAGTGTCCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001012054
ORF Size 450 bp
Insert Size 450
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001012054.1, NP_001012054.1
RefSeq Size 1405
RefSeq ORF 450
Locus ID 307100
Cytogenetics 17q12.2

Other Versions

Other products for "Calml3"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones