Hsd17b1 (NM_012851) Rat Untagged Clone

CAT#: RN201524

Hsd17b1 (untagged ORF) - Rat hydroxysteroid (17-beta) dehydrogenase 1 (Hsd17b1), (10 ug)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Cited in 1 publication.

Product images

Specifications

Product Data
Product Name Hsd17b1 (NM_012851) Rat Untagged Clone
Symbol Hsd17b1
Synonyms 17BHD1; 17BHD1
Vector pCMV6-Entry
Sequence Data
>RN201524 representing NM_012851
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTCCACGGTAGTGCTCATTACCGGTTGCTCTTCTGGAATTGGCCTGCACTTGGCTGTTCGTCTGG
CTTCCGACCGTTCCCAGAGCTTCAAAGTTTATGCCACATTGCGGGATCTGAAGTCACAGGGACCATTGTT
GGAGGCAGCCAGGGCTCAAGGATGCCCTCCTGGCTCCCTGGAGATACTGGAATTGGATGTCAGAGACTCG
GAATCTGTGGCTGCTGCCCGGGCATGCGTGACGGAGGGTCGAGTGGATGTACTGGTCTGTAATGCTGGAC
GCGGCTTGTTCGGGCCGCTGGAAGCGCATGAGTTGAACGCTGTGGGTGCTGTACTGGATGTGAATGTTCT
TGGGACCATCCGGATGCTTCAGGCCTTTCTGCCAGACATGAAAAGGCGCCACTCCGGGCGTGTGCTGGTG
ACTGCGAGTGTGGGAGGTTTGATGGGGCTGCCATTCCACGAAGTGTACTGTGCCAGCAAGTTTGCGCTCG
AAGGTCTGTGCGAGAGTCTGGCGATCCTGCTGCCGCTCTTTGGAGTCCACGTGAGCCTCATCGAGTGCGG
GGCAGTGCACACAGCCTTCCATGAAAAGCTGGAGGGCGGCCCGGGCGGGGCTCTGGAGCGAGCAGATGCC
CAGACCCGCCACCTCTTTGCCCACTATCAGCGTGGTTATGAGCAAGCCCTGAGCGAGGCGCAGGACCCAG
AGGAGGTGACGGAGCTCTTCTTGACTGCGATGCGAGCCCCGCAGCCTGCGCTGCGCTACTTCTCCACAAA
CCGCTTCCTGCCGCTGGCCCGAATGCGCACAGAGGACCCCAGTGGCAGCAGCTACGTCGAAGCCATGCAC
CGCGAGGCCTTCTCTGATCTGCAGGTCCAGGAGGGTGCCAAGGCTGGGGCCCAAGTTTCAGGGGATCCAG
ACACGCCCCCCAGAGCCCTCATTTGTCTCCCCGAGTGTGCAATCCCTAGGGTGACAGCTGAATTGGGATG
GTCTGCATCAGATAAACCGGGTCAGAACAAATCATGTTACCAGCAAAAGATCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_012851
ORF Size 1035 bp
Insert Size 1035
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_012851.2, NP_036983
RefSeq Size 1431
RefSeq ORF 1035
Locus ID 25322
Cytogenetics 10q31
Gene Summary catalyzes the conversion between 17 beta-hydroxy- and 17-ketosteroids; plays a role in estradiol biosynthesis [RGD, Feb 2006]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)