Chfr (NM_001289579) Mouse Untagged Clone

CAT#: MC228169

Chfr (untagged) - Mouse checkpoint with forkhead and ring finger domains (Chfr), transcript variant 4


  "NM_001289579" in other vectors (1)

Reconstitution Protocol

USD 538.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Chfr"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Chfr
Synonyms 5730484M20Rik; C230082M18; RNF116
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC228169 representing NM_001289579
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTCCATGTGACCAAAGATTGCTCAGGTCCAGGGCAGGGTGATGATCCCCAGGTTCCACTATTGTCAC
CCATGGCTCAGACATGCTTAGAGGAACCACAGCCATCAACATCGACATCAGACCTCCTCCCCACGGCCTC
TACCTCTTCTACGGAGCCAGAGCTGACCTCTGCAGGGCAAAAGCATTCTTCTAGCTCTGGACCTGGGAAC
ACAAGCATCTCCCCAAAAGGACGCAGTTCACTTGTTGCAAATGGCGAACTCTCTAGCCTTTCTCCAGTTT
TCCAAGACAAAGAAGCATCCTTTTCTTTGCTGGAAAGTAAAGACCATGAGGAATTGGAGCCTGCCAAAAA
AAAGATGAAAGGAGATGGGGAACTTGACACGAACCTCCAGTTATTAGTTTCAGGCCAGCGTGGAAATGCC
CAAACCTCAAGTGAAGATGTCAAAGATGCCTCTGTGAAGCCAGACAAGATGGAGGAGACACTAACCTGTA
TCATCTGCCAGGACCTTCTGCACGATTGTGTGAGTTTGCAGCCTTGTATGCACACATTTTGTGCGGCTTG
CTACTCTGGTTGGATGGAGCGTTCATCTCTGTGCCCTACCTGCCGATGTCCAGTGGAGCGGATTTGCAAA
AACCACATCCTGAACAACCTAGTGGAAGCATACCTTATCCAGCACCCAGATAAAAGTCGCAGTGAAGAAG
ATGTGAGAAGTATGGATGCAAGGAATAAAATCACTCAAGATATGCTGCAACCCAAAGTCAGGAGGTCTTT
CTCTGATGAAGAGGGGAGTTCAGAGGACCTGCTAGAGCTGTCTGATGTCGACAGTGAATCCTCAGATATC
AGTCAGCCATACATTGTCTGCAGACAGTGTCCTGAATACAGAAGGCAAGCGGTGCAGTCTCTTCCTTGCC
CAGTCCCAGAGAGTGAGCTGGGAGCTACACTGGCCCTTGGTGGGGAGGCACCTTCAACATCTGCCAGCTT
GCCAACAGCAGCCCCGGATTACATGTGCCCTCTTCAAGGAAGCCATGCCATATGCACCTGCTGCTTCCAG
CCTATGCCTGACCGGAGAGCTGAACGGGAGCAGGATCCCCGCGTCGCCCCTCAGCAGTGTGCGGTGTGCC
TGCAGCCCTTCTGCCACCTGTACTGGGGCTGCACGAGGACTGGCTGCTTTGGCTGCTTGGCCCCATTCTG
TGAGCTCAACCTGGGGGACAAGTGCTTGGATGGAGTGCTGAACAATAACAATTATGAATCGGACATCCTG
AAGAATTACCTGGCAACCAGGGGTCTGACATGGAAAAGTGTGTTGACAGAGAGTCTCCTGGCTCTGCAGC
GAGGTGTATTTATGCTGTCTGATTACAGAATCACTGGAAATACTGTGCTGTGTTACTGCTGTGGTCTGCG
TAGCTTCCGAGAGCTGACCTACCAGTATCGTCAGAACATTCCTGCTTCTGAGTTGCCAGTGACTGTAACA
TCCCGTCCTGACTGCTACTGGGGCCGTAACTGTCGCACTCAGGTGAAGGCTCACCATGCAATGAAATTCA
ATCACATCTGTGAGCAAACAAGGTTCAAGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289579
Insert Size 1575 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289579.1, NP_001276508.1
RefSeq Size 3253 bp
RefSeq ORF 1575 bp
Locus ID 231600
UniProt ID Q810L3
Cytogenetics 5 F
Gene Summary E3 ubiquitin-protein ligase that functions in the antephase checkpoint by actively delaying passage into mitosis in response to microtubule poisons. Acts in early prophase before chromosome condensation, when the centrosome move apart from each other along the periphery of the nucleus. Probably involved in signaling the presence of mitotic stress caused by microtubule poisons by mediating the 'Lys-48'-linked ubiquitination of target proteins, leading to their degradation by the proteasome. Promotes the ubiquitination and subsequent degradation of AURKA and PLK1. Probably acts as a tumor suppressor, possibly by mediating the polyubiquitination of HDAC1, leading to its degradation. May also promote the formation of 'Lys-63'-linked polyubiquitin chains and functions with the specific ubiquitin-conjugating UBC13-MMS2 (UBE2N-UBE2V2) heterodimer. Substrates that are polyubiquitinated at 'Lys-63' are usually not targeted for degradation, but are rather involved in signaling cellular stress (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) contains an alternate exon in the 5' region and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.