Mtf2 (NM_001253878) Mouse Untagged Clone

CAT#: MC227992

Mtf2 (untagged) - Mouse metal response element binding transcription factor 2 (Mtf2), transcript variant 3


  "NM_001253878" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mtf2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mtf2
Synonyms 9230112N11Rik; AA537621; C76717; M96; Pcl2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227992 representing NM_001253878
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTCTGTACAATATGTCAAGAAGAGTATTCAGAAGCTCCCAATGAAATGGTTATATGTGATAAGTGTG
GTCAAGGATATCATCAGCTGTGTCACACACCTCATATTGACTCGAGTGTGATTGATTCAGATGAAAAGTG
GCTTTGTCGACAGTGCGTTTTTGCAACAACTACAAAGAGGGGTGGTGCGCTTAAGAAAGGACCAAATGCC
AAAGCATTGCAAGTCATGAAGCAGACATTACCCTATAGTGTGGCTGACCTTGAATGGGATGCAGGCCATA
AAACCAATGTCCAGCAGTGCTACTGCTATTGTGGAGGCCCTGGAGACTGGTATTTAAAGATGCTGCAGTG
CTGCAAATGTAAGCAGTGGTTTCATGAAGCTTGTGTCCAATGCCTTCAGAAGCCAATGCTGTTTGGAGAT
AGGTTTTATACATTTATTTGCTCTGTCTGCAGTTCTGGACCAGAATACCTCAAACGTCTACCGTTACAGT
GGGTAGATATAGCACACCTATGCCTTTACAACCTAAGTGTTATTCACAAGAAGAAATACTTTGATTCTGA
ACTTGAGCTTATGACATACATTAATGAAAACTGGGATAGATTGCACCCTGGAGAGCTGGCAGACACACCC
AAATCTGAAAGATATGAGCATGTTCTGGAGGCATTAAATGATTACAAGACCATGTTTATGTCTGGGAAAG
AAATAAAGAAGAAGAAGCATTTGTTTGGGTTGCGAATTCGTGTTCCTCCTGTGCCACCAAATGTGGCTTT
CAAAGCAGAGAAAGAACCAGAAGGAACATCCCATGAATTTAAAATTAAAGGCAGAAAGGCATCCAAACCT
ACATCTGACTCAAGGGAAGTAAGCAATGGGATAGAAAAAAAAGGAAAGAAAAAATCTGTAGGTCGTCCTC
CTGGCCCATATACAAGAAAAATGATTCAAAAAACTGCTGAGCTACCTTTGGATAAGGAATCAGTTTCAGA
GAATCCTACGTTGGATTTACCTTGTTCTATAGGGAGAACTGAGGGAATTGCACATTCATCCAATACCTCA
GATGTGGACCTCACGGGTGCTTCCAGTGCAAACGAAACTACCTCGGCTAGCATTTCCAGGCATTGTGGAT
TATCAGACTCTAGAAAAAGAACTCGCACAGGAAGATCATGGCCTGCTGCAATACCACATTTGCGGAGAAG
AAGAGGTCGCCTTCCACGAAGAGCACTCCAGACTCAGAACTCAGAAGTTGTGAAAGATGATGAAGGCAAA
GAAGATTATCAGTTTGAAGAACTTAACACAGAAATTCTGAATAACTTAGCAGATCAGGAGTTGCAGCTCA
ATCACCTGAAAAACTCCATCACTAGTTATTTTGGTGCCGCAGGTAGAATAGCATGTGGCGAAAAATACAG
AGTTTTGGCTCGTCGGGTGACGCTTGATGGGAAGGTGCAGTATCTTGTGGAATGGGAAGGAGCGACTGCA
TCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253878
Insert Size 1476 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253878.1, NP_001240807.1
RefSeq Size 4424 bp
RefSeq ORF 1476 bp
Locus ID 17765
UniProt ID Q02395
Cytogenetics 5 F
Gene Summary Polycomb group (PcG) that specifically binds histone H3 trimethylated at 'Lys-36' (H3K36me3) and recruits the PRC2 complex. Acts by binding to H3K36me3, a mark for transcriptional activation, and recruiting the PRC2 complex, leading to enhance PRC2 H3K27me3 methylation activity. Regulates the transcriptional networks during embryonic stem cell self-renewal and differentiation. Promotes recruitment of the PRC2 complex to the inactive X chromosome in differentiating XX ES cells and PRC2 recruitment to target genes in undifferentiated ES cells. Required to repress Hox genes by enhancing H3K27me3 methylation of the PRC2 complex. In some conditions may act as an inhibitor of PRC2 activity: able to activate the CDKN2A gene and promote cellular senescence by suppressing the catalytic activity of the PRC2 complex locally. Binds to the metal-regulating-element (MRE) of MT1A gene promoter.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 7, which results in the use of a downstream AUG start codon. The resulting isoform (2) is shorter at the N-terminus compared to isoform 3. Variants 2-6 all encode the same isoform (2).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.