Mst1r (NM_001287261) Mouse Untagged Clone

CAT#: MC227896

Mst1r (untagged) - Mouse macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (Mst1r), transcript variant 2


  "NM_001287261" in other vectors (1)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mst1r"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mst1r
Synonyms CD136; CDw136; Fv; Fv-; Fv-2; Fv2; PTK; PTK8; Ron; ST; STK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227896 representing NM_001287261
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCGTGGGTGGTGAGGTCTGCCAACATGAGCTCCGGGGGGATGTGGTGATCTGCCCCCTGCCCCCTT
CCCTGCAACTTGGCAAGGATGGTGTCCCATTGCAGGTCTGTGTAGACGGTGGGTGTCACATCCTGAGCCA
AGTGGTTCGCTCAAGCCCAGGCAGGGCCTCACAGAGGATACTCCTTATTGCTCTTCTGGTCTTGATCCTG
CTTGTGGCTGTGCTGGCCGTTGCCCTGATCTTTAACTCCCGAAGACGGAAAAAGCAGCTAGGTGCTCACT
CCCTCTCCCCAACAACACTCTCTGACATCAACGATACAGCTTCCGGGGCTCCGAACCATGAAGAATCGTC
AGAGAGTAGGGATGGGACAAGTGTCCCACTGCTGCGGACAGAGTCTATCCGGCTCCAGGATCTGGACAGG
ATGCTCCTAGCTGAGGTCAAGGATGTACTGATTCCCCATGAACAAGTGGTCATCCATACTGACCAAGTCA
TTGGCAAAGGCCACTTTGGTGTTGTCTACCACGGAGAATATACAGACGGAGCACAGAATCAGACCCACTG
TGCCATCAAGTCTCTGAGTCGCATTACAGAGGTGCAGGAGGTGGAGGCTTTCCTGCGGGAGGGGCTGCTC
ATGCGTGGCCTACATCACCCAAACATCCTGGCTCTCATCGGTATCATGCTGCCCCCGGAGGGGCTTCCCC
GGGTGCTGTTGCCCTATATGCGCCACGGAGACCTGCTTCATTTCATTCGCTCCCCTCAGAGGAACCCCAC
TGTGAAGGATCTTGTCAGCTTTGGCCTGCAGGTAGCCTGTGGTATGGAGTACCTGGCAGAGCAGAAGTTC
GTGCACAGAGACCTGGCTGCTAGGAACTGCATGCTGGACGAGTCATTCACAGTCAAGGTGGCTGACTTTG
GTCTGGCACGGGGCGTCCTAGACAAGGAATACTACAGTGTTCGCCAGCATCGCCATGCTCGCCTGCCAGT
CAAATGGATGGCACTGGAGAGCCTGCAGACCTACAGGTTCACCACCAAGTCCGATGTGTGGTCATTCGGG
GTGCTGCTCTGGGAGCTACTAACACGGGGTGCTCCACCCTACCCCCATATCGATCCCTTCGACCTCTCTC
ACTTCCTGGCTCAGGGCCGTCGCCTGCCTCAGCCTGAGTACTGTCCTGATTCACTGTATCACGTGATGCT
TCGATGCTGGGAGGCTGACCCAGCGGCACGACCCACCTTCAGAGCCCTAGTGCTGGAAGTAAAGCAGGTA
GTGGCCTCACTGCTTGGGGACCACTATGTGCAGCTGACAGCAGCTTATGTGAACGTAGGCCCCAGAGCGG
TGGATGATGGGAGTGTGCCTCCGGAGCAGGTACAGCCCTCGCCTCAGCATTGCAGGAGCACGTCAAAGCC
CCGGCCTCTCTCAGAGCCACCCCTGCCCACTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001287261
Insert Size 1434 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287261.1, NP_001274190.1
RefSeq Size 1796 bp
RefSeq ORF 1434 bp
Locus ID 19882
Cytogenetics 9 F1
Gene Summary This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) represents the use of an alternate promoter, differs in the 5' UTR, lacks a significant portion of the 5' coding region and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (2, also known as short-form Ron or SF-Ron or sf-Stk) has a shorter N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.