Hormad1 (NM_001289537) Mouse Untagged Clone

CAT#: MC227348

Hormad1 (untagged) - Mouse HORMA domain containing 1 (Hormad1), transcript variant 3

USD 361.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Hormad1 (NM_001289537) Mouse Untagged Clone
Symbol Hormad1
Synonyms 4921522K05Rik; Nohma
Vector pCMV6-Entry
Sequence Data
>MC227348 representing NM_001289537
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACTATGCAGTTGCAGAGGACAGCTTCCCTGAGTGCATTGGTATTTCCCAATAAGATATCAACTG
AGCATCAATCTTTGATGTTTGTGAAGAGGCTCCTAGCTGTTTCAGTATCTTGCATCACCTATTTGAGAGG
AATATTTCCAGAACGTGCTTATGGGACAAGATATCTGGATGATCTCTGTGTCAAAATTCTGAAAGAAGAT
AAAAATTGTCCAGGTTCTTCACAGCTAGTGAAGTGGATGCTTGGATGCTATGATGCTTTACAGAAGAAAT
ATCTAAGGATGATCATTCTAGCTGTATACACCAATCCAGGAGATCCTCAGACAATTTCAGAATGTTACCA
GTTTAAATTCAAGTACACCAAAAATGGACCAATCATGGACTTTATAAGCAAAAATCAAAACAATAAATCT
AGTACAACATCTGCTGACACCAAGAAAGCAAGTATTCTCCTCATTCGGAAGATTTATGTCTTAATGCAAA
ATCTAGGACCATTACCTAATGATGTTTGTCTGACCATGAAACTTTTTTACTATGATGAAGTTACACCCCC
AGATTACCAACCACCAGGTTTTAAGGATGGTGACTGTGAAGGAGTAATATTTGATGGGGACCCTACATAC
TTAAATGTGGGAGAAGTCCCAACACCTTTTCACACCTTCAGATTAAAAGTGACCACTGAGAAGGAACGAA
TGGAAAATATTGATTCAACCATACTAAAACCAAAAGAATCAAAAACACAATTTGAAAAAATTCTAATGGA
CAAAGATGATGTGGAAGATGAAAATCATAATAATTTTGACATTAAAACTAAAATGAACGAACAGAATGAA
AACTCTGGAGCTTCTGAAATCAAAGAACCAAATTTAGATTGTAAGGAAGAAGAAACTATGCAATTCAAAA
AGAGCCAAAGTCCTTCAATTTCTCATTGTCAGGTTGAACAGTTAGTCAGTAAAACATCTGAACTTGATGT
GTCTGAAAGCAAAACAAGAAGCGGAAAAATCTTTCAGAGTAAAATGGTAAATGGAAATAATCAACAAGGA
CAAACTTCTAAAGAAAATCGGAAGAGAAGTCTTCGTCAATTTAGGAAAACAATAAATGCACCTGAGTGTA
GGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001289537
ORF Size 1125 bp
Insert Size 1125
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001289537.1, NP_001276466
RefSeq Size 1438
RefSeq ORF 1125
Locus ID 67981
Cytogenetics 3|3 F2.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.