Hormad1 (NM_001289534) Mouse Untagged Clone

CAT#: MC227347

Hormad1 (untagged) - Mouse HORMA domain containing 1 (Hormad1), transcript variant 2


  "NM_001289534" in other vectors (1)

Reconstitution Protocol

USD 503.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Hormad1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hormad1
Synonyms 4921522K05Rik; Nohma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227347 representing NM_001289534
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACTATGCAGTTGCAGAGGACAGCTTCCCTGAGTGCATTGGTATTTCCCAATAAGATATCAACTG
AGCATCAATCTTTGATGTTTGTGAAGAGGCTCCTAGCTGTTTCAGTATCTTGCATCACCTATTTGAGAGG
AATATTTCCAGAACGTGCTTATGGGACAAGATATCTGGATGATCTCTGTGTCAAAATTCTGAAAGAAGAT
AAAAATTGTCCAGGTTCTTCACAGCTAGTGAAGTGGATGCTTGGATGCTATGATGCTTTACAGAAGAAAT
ATCTAAGGATGATCATTCTAGCTGTATACACCAATCCAGGAGATCCTCAGACAATTTCAGAATGTTACCA
GTTTAAATTCAAGTACACCAAAAATGGACCAATCATGGACTTTATAAGCAAAAATCAAAACAATAAATCT
AGTACAACATCTGCTGACACCAAGAAAGCAAGTATTCTCCTCATTCGGAAGATTTATGTCTTAATGCAAA
ATCTAGGACCATTACCTAATGATGTTTGTCTGACCATGAAACTTTTTTACTATGATGAAGTTACACCCCC
AGATTACCAACCACCAGGTTTTAAGGATGGTGACTGTGAAGGAGTAATATTTGATGGGGACCCTACATAC
TTAAATGTGGGAGAAGTCCCAACACCTTTTCACACCTTCAGATTAAAAGTGACCACTGAGAAGGAACGAA
TGGAAAATATTGATTCAACCATACTAAAACCAAAAGAATCAAAAACACAATTTGAAAAAATTCTAATGGA
CAAAGATGATGTGGAAGATGAAAATCATAATAATTTTGACATTAAAACTAAAATGAACGAACAGAATGAA
AACTCTGGAGCTTCTGAAATCAAAGAACCAAATTTAGATTGTAAGGAAGAAGAAACTATGCAATTCAAAA
AGAGCCAAAGTCCTTCAATTTCTCATTGTCAGGTTGAACAGTTAGTCAGTAAAACATCTGAACTTGATGT
GTCTGAAAGCAAAACAAGAAGCGGAAAAATCTTTCAGAGTAAAATGGTAAATGGAAATAATCAACAAGGA
CAAACTTCTAAAGAAAATCGGAAGAGAAGTCTTCGTCAATTTAGGAAAACAATAAATGCACCTGAGTGTA
GGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289534
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289534.1, NP_001276463.1
RefSeq Size 1709 bp
RefSeq ORF 1125 bp
Locus ID 67981
UniProt ID Q9D5T7
Cytogenetics 3 F2.1
Gene Summary Plays a key role in meiotic progression (PubMed:19686734, PubMed:21079677, PubMed:21478856). Regulates 3 different functions during meiosis: ensures that sufficient numbers of processed DNA double-strand breaks (DSBs) are available for successful homology search by increasing the steady-state numbers of single-stranded DSB ends (PubMed:19686734, PubMed:21079677). Promotes synaptonemal-complex formation independently of its role in homology search (PubMed:19686734, PubMed:21079677). Plays a key role in the male mid-pachytene checkpoint and the female meiotic prophase checkpoint: required for efficient build-up of ATR activity on unsynapsed chromosome regions, a process believed to form the basis of meiotic silencing of unsynapsed chromatin (MSUC) and meiotic prophase quality control in both sexes (PubMed:21478856).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Variants 2, 3, and 4 all encode the same isoform (b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.