Cops2 (NM_001285512) Mouse Untagged Clone

CAT#: MC227009

Cops2 (untagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) (Cops2), transcript variant 3


  "NM_001285512" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cops2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cops2
Synonyms AI315723; C85265; Csn2; Sgn2; TRIP-15; Trip15
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC227009 representing NM_001285512
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATTTACTGCAGGAATTTTATGAAACAACACTGGAAGCTTTGAAAGATGCTAAGAATGATAGACTGT
GGTTTAAGACAAACACAAAGCTTGGAAAATTATATTTAGAACGAGAAGAATATGGAAAGCTTCAAAAAAT
TTTACGACAGTTACATCAGTCTTGTCAGACTGATGATGGAGAAGATGACCTGAAAAAAGGTACCCAGTTA
TTAGAAATCTATGCTTTGGAAATTCAAATGTACACTGCACAGAAGAACAACAAAAAGCTTAAAGCACTCT
ATGAGCAATCACTTCACATCAAGTCTGCCATCCCTCACCCACTAATCATGGGTGTCATCAGAGAATGCGG
TGGTAAGATGCACTTGAGAGAAGGTGAATTTGAAAAGGCACACACTGATTTTTTTGAAGCCTTCAAGAAT
TATGATGAATCAGGAAGCCCAAGACGAACCACTTGTTTAAAATATTTGGTTTTAGCAAATATGCTAATGA
AATCAGGAATAAATCCGTTTGACTCACAAGAGGCCAAGCCGTATAAAAATGATCCAGAAATTCTAGCAAT
GACAAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTGAAAACAAATCAC
AGCAACATCATGGATGATCCTTTCATAAGAGAGCACATTGAAGAACTTTTACGAAACATCAGAACACAAG
TCCTCATAAAGTTAATTAAGCCTTACACAAGAATACATATTCCTTTTATTTCTAAGGAGCTAAACATAGA
CGTAGCTGATGTGGAGAGCTTGCTGGTGCAGTGCATACTGGATAACACTATTCATGGCCGAATTGATCAA
GTCAACCAGCTCCTTGAACTGGATCATCAGAAGAGGGGTGGTGCCCGATACACTGCGCTAGATAAATGGA
CCAACCAACTAAATTCTCTGAACCAGGCTGTGGTCAGTAAACTGGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001285512
Insert Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001285512.1, NP_001272441.1
RefSeq Size 3380 bp
RefSeq ORF 960 bp
Locus ID 12848
UniProt ID P61202
Cytogenetics 2 61.76 cM
Gene Summary Essential component of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8/ICSBP, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. Involved in early stage of neuronal differentiation via its interaction with NIF3L1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon compared to variant 1. The encoded isoform (c) is shorter than isoform a. Variants 3 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.