Snrpa (NM_001285825) Mouse Untagged Clone

CAT#: MC226800

Snrpa (untagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 3

USD 279.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Snrpa (NM_001285825) Mouse Untagged Clone
Symbol Snrpa
Synonyms C430021M15Rik; Rnu1a-1; Rnu1a1; U1-A; U1A
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC226800 representing NM_001285825
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACCATAGCCACCATGCCAGTTCCCGAGACCCGTGCCAACCACACTATTTATATCAACAATCTCA
ATGAGAAGATCAAGAAGGATGAGCTCAAGAAGTCCCTGTATGCCATCTTCTCCCAGTTTGGCCAGATCCT
GGATATCCTGGTGTCTCGGATCATGAAGATGAGGGGCCAGGCCTTCGTCATCTTCAAGGAGGTCACCAGC
GCCACCAATGCCCTGCGCTCCATGCAGGGCTTCCCTTTCTACGACAAGCCCATGCGCATCCAGTACGCAA
AGACTGACTCGGACATCATTGCCAAGATGAAGGGCACCTATGTGGAGAGAGATCGCAAACGAGAGAAGAG
GAAGCCCAAGAGTCAGGAGACACCTGCTGCCAAAAAGGCTGTTCAGGGTGGGGCAGCTGCGCCCGTGGTG
GGGGCTGTCCAGCCCGTACCGGGCATGCCACCGATGCCTCAGGCACCCCGCATCATGCACCATATGCCAG
GACAGCCTCCCTACATGCCGCCACCTGGCATGATCCCGCCACCAGGCCTCGCTCCTGGCCAGATCCCCCC
TGGGGCCATGCCCCCACAGCAGCTCATGCCTGGGCAGATGCCGCCTGCCCAGCCTCTCTCCGAGAACCCA
CCCAATCACATCCTGTTCCTCACCAACCTGCCTGAGGAGACCAACGAGCTCATGCTCTCCATGCTCTTCA
ACCAGTTCCCTGGCTTCAAGGAGGTGCGTCTGGTCCCTGGGCGCCATGACATCGCCTTCGTGGAGTTTGA
CAATGAAGTGCAGGCTGGGGCAGCACGAGATGCCCTGCAAGGCTTTAAGATCACACAAAACAATGCTATG
AAGATCTCTTTTGCCAAGAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001285825
ORF Size 864 bp
Insert Size 864
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001285825.1, NP_001272754
RefSeq Size 1379
RefSeq ORF 864
Locus ID 53607
Cytogenetics 7|7 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.