Cd82 (NM_001271430) Mouse Untagged Clone

CAT#: MC226683

Cd82 (untagged) - Mouse CD82 antigen (Cd82), transcript variant 4

USD 258.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cd82 (NM_001271430) Mouse Untagged Clone
Symbol Cd82
Synonyms AA682076; AL023070; C33; IA4; Kai1; Tspan27
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>MC226683 representing NM_001271430
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGCAGGCTGTGTCAAAGTCACCAAGTATTTCCTCTTCCTCTTCAACTTGCTGTTCTTTATCCTGG
GTGCTGTGATCCTGGGCTTCGGGGTGTGGATTCTTGCAGACAAGAACAGCTTCATTTCCGTCCTACAAAC
CTCATCCAGCTCGCTGCAGGTGGGGGCTTACGTCTTCATCGGTGTGGGCGCCATCACCATAGTGATGGGC
TTCCTGGGCTGTATCGGTGCTGTCAATGAGGTCCGCTGCTTGCTGGGTCTGTACTTTGTCTTCCTTCTGC
TGATCCTCATCGCACAGGTGACCGTAGGGGTCCTCTTCTACTTCAACGCTGACAAGCTGAAGAAGGAGAT
GGGGAACACAGTGATGGACATCATTCGCAACTACACTGCCAATGCCACCAGTAGCCGCGAGGAGGCCTGG
GACTACGTGCAGGCGCAGGTCAAGTGCTGTGGCTGGGTCAGCCACTACAACTGGACAGAGAACGAGGAGC
TCATGGGCTTTACCAAGACCACTTACCCATGCTCCTGCGAGAAGATCAAGGAAGAGGACAACCAGCTCAT
TGTGAAGAAAGGATTCTGTGAGGCTGATAACAGCACTGTGAGCGAAAACAACCCTGAGGATTGGCCTGTG
AACACTGAGGGCTGCATGGAGAAGGCGCAGGCGTGGCTTCAGGAGAACTTCGGCATCCTTCTGGGCGTGT
GTGCTGGTGTTGCTGTCATTGAGCTGCTGGGGTTGTTCCTGTCCATATGTTTGTGCCGGTACATTCATTC
TGAAGACTACAGCAAGGTCCCCAAGTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001271430
ORF Size 801 bp
Insert Size 801
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001271430.1, NP_001258359
RefSeq Size 1757
RefSeq ORF 801
Locus ID 12521
Cytogenetics 2 E1|2 51.62 cM
Gene Summary Associates with CD4 or CD8 and delivers costimulatory signals for the TCR/CD3 pathway. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.