Cd63 (NM_001282966) Mouse Untagged Clone
CAT#: MC226494
Cd63 (untagged) - Mouse CD63 antigen (Cd63), transcript variant 3
"NM_001282966" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cd63 |
Synonyms | C75951; ME491; Tspan30 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226494 representing NM_001282966
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGTTTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCT GTGCAGTGGGATTGATCGCCATTGGTGTAGCGGTTCAGGTTGTCTTGAAGCAGGCCATTACCCATGAGAC TACTGCTGGCTCGCTGTTGCCTGTGGTCATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTG GGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTCATGATTACATTTGCCATCTTCCTGTCTCTTATCA TGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACCAGGTGAAGTCAGAGTTTAATAA AAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATTTTGGACAAATTGCAG AAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGGAAAACATCCCCGGCATGGCCAAGGACA GAGTCCCCGATTCTTGCTGCATCAACATAACTGTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCA TACCCAGGGCTGCGTGGAGACTATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCC CTGGGCATTGCTTTTGTGGAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTG GCTATGAAGTAATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282966 |
Insert Size | 717 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282966.1, NP_001269895.1 |
RefSeq Size | 999 bp |
RefSeq ORF | 717 bp |
Locus ID | 12512 |
UniProt ID | P41731 |
Cytogenetics | 10 77.19 cM |
Gene Summary | Functions as cell surface receptor for TIMP1 and plays a role in the activation of cellular signaling cascades. Plays a role in the activation of ITGB1 and integrin signaling, leading to the activation of AKT, FAK/PTK2 and MAP kinases. Promotes cell survival, reorganization of the actin cytoskeleton, cell adhesion, spreading and migration, via its role in the activation of AKT and FAK/PTK2. Plays a role in VEGFA signaling via its role in regulating the internalization of KDR/VEGFR2. Plays a role in intracellular vesicular transport processes, and is required for normal trafficking of the PMEL luminal domain that is essential for the development and maturation of melanocytes. Plays a role in the adhesion of leukocytes onto endothelial cells via its role in the regulation of SELP trafficking. May play a role in mast cell degranulation in response to Ms4a2/FceRI stimulation, but not in mast cell degranulation in response to other stimuli.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228705 | Cd63 (myc-DDK-tagged) - Mouse CD63 antigen (Cd63), transcript variant 3 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review