Gid8 (NM_001289652) Mouse Untagged Clone

CAT#: MC226421

Gid8 (untagged) - Mouse GID complex subunit 8 homolog (S. cerevisiae) (Gid8), transcript variant 3


  "NM_001289652" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gid8"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Gid8
Synonyms 2310003C23Rik; 4833420G11Rik; AI451474; Twa1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226421 representing NM_001289652
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTTATGCAGAAAAGCCGGATGAAATAACCAAAGATGAATGGATGGAAAAGCTCAATAACTTGCATG
TTCAACGAGCAGACATGAACCGACTCATCATGAACTACCTAGTCACAGAGGGCTTTAAGGAAGCAGCAGA
GAAATTTCGGATGGAGTCTGGGATCGAACCAAGTGTGGACCTAGAAACACTTGATGAGCGAATCAAGATT
CGGGAGATGATTCTGAAGGGTCAGATCCAGGAGGCCATTGCCTTGATCAACAGCCTCCACCCAGAGCTCC
TAGACACAAACCGGTATCTTTACTTCCACCTTCAGCAACAACACTTGATTGAGCTTATCCGTCAGCGTGA
GACAGAAGCAGCATTGGAGTTTGCCCAGACACAACTGGCAGAGCAGGGTGAGGAAAGCCGAGAATGCCTC
ACAGAGATGGAGCGCACACTGGCCTTGCTGGCCTTCGATAGCCCTGAGGAGTCGCCTTTTGGAGACCTCC
TTCACATGATGCAGAGGCAAAAGGTATGGAGTGAAGTTAACCAGGCTGTTCTGGATTATGAGAATCGAGA
GTCCACACCCAAGCTGGCAAAATTACTGAAACTGCTACTTTGGGCTCAGAATGAGCTAGACCAGAAGAAA
GTAAAATATCCCAAAATGACAGACCTCAGCAAAGGTGTGATTGAGGAGCCCAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289652
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289652.1, NP_001276581.1
RefSeq Size 4412 bp
RefSeq ORF 687 bp
Locus ID 76425
UniProt ID Q9D7M1
Cytogenetics 2 H4
Gene Summary Core component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1. Acts as a positive regulator of Wnt signaling pathway by promoting beta-catenin (CTNNB1) nuclear accumulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.