Spc25 (NM_001199124) Mouse Untagged Clone

CAT#: MC226408

Spc25 (untagged) - Mouse SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) (Spc25), transcript variant 3


  "NM_001199124" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SPC25 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Spc25"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Spc25
Synonyms 2600017H08Rik; 2610205L13Rik; Spbc; Spbc25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226408 representing NM_001199124
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTGAAGACGAATTGGCACTCTTAAATCAAAGCATCAATGAATTTGGGGATAAGTTCAGAAACAGAC
TCGATGATAATCATAGTCAAGTGCTGGGACTTAGAGACGCCTTCAAGGACTCCATGAAAGCGTTTTCAGA
AAAGATGTCTTTGAAATTAAAGGAAGAAGAGAGGATGACTGAGATGATTCTGGAGTATAAAAACCAGCTC
TGTAAGCAGAATAAGCTCATTCAAGAAAAGAAAGAGAATGTGTTGAAGATGATTGCTGAAGTAAAAGGCA
AGGAGCAAGAGTCGGAAGAGCTGACTGCTAAAATCCAGGAGCTCAAGGAAGAGTACGCTAGGAAGAGGGA
AACCATTTCCACTGCTAACAAAGCTAATGAAGAGAGATTGAAAGGACTGCAGAAATCAGCGGATCTGTAT
AGAGATTACCTTGGACTAGAAATTAGAAAGATTCACGGTAATAAATTGCAGTTTATATTTACTAGTATTG
ACCCTAAGAATCCTGAGAGCCCATATATGTTTTCCATGAGCATAAATGAAGCTAAGGAATATGAAGTGTA
CGACAGTTCGCCTCATCTTGAGTGCCTAGCAGAATTTCAGGAGAAAGTCAGGAAGACCAACAATTTTTCA
GCTTTTCTTGCCAATATTCGGAAGGCTTTTATAGCTAAGGTTCATAATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199124
Insert Size 681 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199124.2, NP_001186053.1
RefSeq Size 1388 bp
RefSeq ORF 681 bp
Locus ID 66442
UniProt ID Q3UA16
Cytogenetics 2 C2
Gene Summary This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.