Rab27a (NM_001301230) Mouse Untagged Clone

CAT#: MC226378

Rab27a (untagged) - Mouse RAB27A, member RAS oncogene family (Rab27a), transcript variant 1

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rab27a
• Synonyms: 2210402C08Rik; 2410003M20Rik; 4933437C11Rik; ash
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC226378 representing NM_001301230
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCGGATGGAGATTACGATTACCTCATCAAGTTCTTGGCCTTGGGAGACTCTGGGGTAGGGAAGACCA
  GTGTACTCTACCAGTACACTGATGGCAAGTTCAACTCCAAATTCATCACCACAGTGGGCATTGATTTCAG
  GGAAAAGAGAGTGGTGTACAGAGCCAATGGGCCAGATGGAGCTGTGGGCCGAGGCCAGAGAATCCACCTG
  CAGTTATGGGACACGGCGGGGCAGGAGAGGTTTCGTAGCTTAACCACTGCATTCTTCAGGGACGCTATGG
  GTTTCCTGCTTCTGTTCGACCTGACAAATGAGCAAAGTTTCCTCAATGTCCGAAACTGGATAAGCCAGCT
  ACAGATGCACGCGTACTGTGAAAACCCAGATATAGTGCTGTGTGGAAATAAGAGTGACCTGGAAGACCAG
  AGGGCAGTGAAAGAGGAGGAGGCCCGGGAACTTGCCGAGAAGTACGGAATCCCCTATTTTGAAACCAGTG
  CTGCCAACGGGACAAACATAAGCCACGCGATTGAGATGCTCCTGGACCTGATCATGAAGCGGATGGAGCG
  GTGTGTGGACAAGTCCTGGATTCCGGAGGGAGTGGTACGGTCCAACGGCCATACCTCTGCGGATCAGCTA
  AGTGAGGAGAAGGAGAAGGGGTTGTGTGGCTGTTGA
  
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
  TGGATTACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001301230
• Insert Size: 666 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301230.1, NP_001288159.1
• RefSeq Size: 3215 bp
• RefSeq ORF: 666 bp
• Locus ID: 11891
• UniProt ID: Q9ERI2
• Cytogenetics: 9 40.08 cM
• Gene Summary: The protein encoded by this gene is a member of the Rab family of proteins, which is the largest family within the Ras superfamily of GTPases. This gene product is thought to regulate vesicular transport, together with its specific effectors. Mutations in this gene cause several defects, including actin-based melanosome transport defects and immunodeficiency. Mutations in the human ortholog of this gene are associated with Griscelli syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein.