Artn (NM_001284192) Mouse Untagged Clone
CAT#: MC226243
Artn (untagged) - Mouse artemin (Artn), transcript variant 2
"NM_001284192" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Artn |
Synonyms | neub; neublastin |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226243 representing NM_001284192
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAACTGGGACTTGCAGAGCCTACTGCATTGTCCCACTGCCTCCGGCCTAGGTGGCAGTCAGCCTGGT GGCCAACCCTAGCTGTTCTAGCCCTGCTGAGCTGCGTCACAGAAGCTTCCCTGGACCCAATGTCCCGCAG CCCCGCCGCTCGCGACGGTCCCTCACCGGTCTTGGCGCCCCCCACGGACCACCTGCCTGGTAGGGGGACA CACTGCGCATTTGTGCAGCGAAAGAACCCTGCGACCCCCGCCTCAGTCTCCTCAGCCCGCACCCCCGCCG CCTGGTCCCGCGCTCCAGTCTCCTCCCGCTGCGCTCCGCGGGGCACGCGCGGCGCGTGCAGGAACCCGGA GCAGCCGCGCACGGACCACAGATGCGCGCGGCTGCCGCCTGCGCTCGCAGCTGGTGCCGGTGAGTGCGCT CGGCCTAGGCCACAGCTCCGACGAGCTGATACGTTTCCGCTTCTGCAGCGGCTCGTGCCGCCGAGCACGC TCCCAGCACGATCTCAGTCTGGCCAGCCTACTGGGCGCTGGGGCCCTACGGTCGCCTCCCGGGTCCCGGC CGATCAGCCAGCCCTGCTGCCGGCCCACTCGCTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001284192 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001284192.1, NP_001271121.1 |
RefSeq Size | 2327 bp |
RefSeq ORF | 597 bp |
Locus ID | 11876 |
UniProt ID | Q9Z0L2 |
Cytogenetics | 4 D1 |
Gene Summary | This gene encodes a secreted ligand of the glial cell line-derived neurotrophic factor (GDNF) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein signals through the RET receptor and GFR alpha 3 coreceptor, and supports the survival of a number of peripheral neuron populations and at least one population of dopaminergic CNS neurons. Mice lacking a functional copy of this gene exhibit ptosis and impaired development of the sympathetic nervous system. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded protein (isoform 2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228454 | Artn (myc-DDK-tagged) - Mouse artemin (Artn), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review