Cryaa (NM_001278570) Mouse Untagged Clone
CAT#: MC226065
Cryaa (untagged) - Mouse crystallin, alpha A (Cryaa), transcript variant 3
"NM_001278570" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cryaa |
Synonyms | Acry; Acry-1; Cry; Crya; Crya-1; Crya1; DAcry; DAcry-1; lop18 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226065 representing NM_001278570
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGTCACCATTCAGCATCCTTGGTTCAAGCGTGCCCTGGGGCCCTTCTACCCCAGCCGACTGTTCG ACCAGTTCTTCGGCGAGGGCCTTTTTGAGTACGACCTGCTGCCCTTCCTGTCTTCCACCATCAGCCCCTA CTACCGCCAGTCCCTCTTCCGCACTGTGCTGGACTCGGGCATCTCTGAGGTCCGATCTGACCGGGACAAG TTTGTCATCTTCTTGGACGTGAAGCACTTCTCTCCTGAGGACCTCACCGTGAAGGTACTGGAGGATTTTG TGGAGATTCACGGCAAACACAACGAGAGGCAGGATGACCATGGCTACATTTCCCGTGAATTTCACCGTCG CTACCGTCTGCCTTCCAATGTGGACCAGTCCGCCCTCTCCTGCTCCCTGTCTGCGGATGGCATGCTGACC TTCTCTGGCCCCAAGGTCCAGTCCGGTTTGGATGCTGGCCACAGCGAGAGGGCCATTCCTGTGTCACGGG AGGAGAAACCCAGCTCTGCACCCTCGTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278570 |
Insert Size | 522 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278570.1, NP_001265499.1 |
RefSeq Size | 1127 bp |
RefSeq ORF | 522 bp |
Locus ID | 12954 |
Cytogenetics | 17 17.09 cM |
Gene Summary | This gene encodes subunit a, one of two subunits of alpha-crystallin, which is a high molecular weight, soluble aggregate and is a member of the small heat shock protein (sHSP) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. It acts as a molecular chaperone and is the major protein in the eye lens, maintaining the transparency and refractive index of the lens. In mouse, deficiency in this gene is associated with smaller lenses and eyes and with increasing lens opacity with age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 3 which is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228276 | Cryaa (myc-DDK-tagged) - Mouse crystallin, alpha A (Cryaa), transcript variant 3 |
USD 300.00 |
{0} Product Review(s)
Be the first one to submit a review