Clec9a (NM_001205365) Mouse Untagged Clone
CAT#: MC226064
Clec9a (untagged) - Mouse C-type lectin domain family 9, member a (Clec9a), transcript variant 4
"NM_001205365" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Clec9a |
Synonyms | 9830005G06Rik; DNGR-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226064 representing NM_001205365
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCATGCGGAAGAAATATATACCTCTCTTCAGTGGGACATTCCTACCTCAGAGGCCTCTCAGAAGTGCC AATCCCCTAGCAAATGTTCAGGAGCATGGTGTGTTGTGACGATGATTTCCTGTGTGGTCTGTATGGGCTT GTTAGCAACGTCCATTTTCTTGGGCATCAAGTTCTTCCAGGTATCCTCTCTTGTCTTGGAGCAGCAGGAA AGACTCATCCAACAGGACACAGCATTGGTGAACCTTACACAGTGGCAGAGGAAATACACACTGGAATACT GCCAAGCCTTACTGCAGAGATCTCTCCATTCAGGTTGCCAGCAGAAAGACAGCGATCAGCCGGCCAGATC TGTGGATACCTCAAAGATTCTACTCTCATCTCAGATAAGTGCGATAGCTGGAAATATTTTATCTGTGAGA AGAAGGCATTTGGATCCTGCATCTGAAAGATACAACTCAAAGCTACCTGTTACACAAGTGTTTGAAAGAG GCCAAAGAGCAAACACAGGAGGAGATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001205365 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001205365.1, NP_001192294.1 |
RefSeq Size | 2945 bp |
RefSeq ORF | 519 bp |
Locus ID | 232414 |
UniProt ID | Q8BRU4 |
Cytogenetics | 6 F3 |
Gene Summary | Functions as an endocytic receptor on a small subset of myeloid cells specialized for the uptake and processing of material from dead cells. Recognizes filamentous form of actin in association with particular actin-binding domains of cytoskeletal proteins, including spectrin, exposed when cell membranes are damaged, and mediate the cross-presentation of dead-cell associated antigens in a Syk-dependent manner.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) lacks three consecutive exons in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228275 | Clec9a (myc-DDK-tagged) - Mouse C-type lectin domain family 9, member a (Clec9a), transcript variant 4 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review