Med27 (NM_001290489) Mouse Untagged Clone
CAT#: MC226062
Med27 (untagged) - Mouse mediator complex subunit 27 (Med27), transcript variant 3
"NM_001290489" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Med27 |
Synonyms | 1500015J03Rik; 2310042P07Rik; AA682045; Crsp8; D2Ertd434e |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226062 representing NM_001290489
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTGTGTCTGCCAAGCGGAGACCGAAGGCCCAGCCCACCACTCTGGTTCTACCACCTCAGTATGTCG ATGACGTGATCAGCCGCATTGACAGAATGTTTCCAGAGATGTCCATTCACTTATCGAGACCCAATGGGAC TTCAGCAATGCTTCTGGTGACCTTGGGGAAGGTGTTGAAAGTCATTGTGGTCATGAGGAGCCTGTTCATC GATCGCACGATTGTGAAGGGGTATAATGAGAGCGTCTACACAGAGGATGGAAAGCTGGACATATGGTCCA AATCCAGCTACCAAGTGTTCCAGAAGGTGACAGACCATGCCACCACTGCCCTGCTTCACTATCAGTTACC CCAGATGCCAGACGTCGTGGTCAGGTCCTTCATGACCTGGCTGAGAAGCTACATTAAGCTGTTCCAGGCC CCGTGCCAGCGCTGTGGGAAGTTTCTACAAGATGGCCTTCCCCCGACGTGGAGAGACTTCCGAACCCTGG AAGCTTTCCATGACACCTGCCGACAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290489 |
Insert Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290489.1, NP_001277418.1 |
RefSeq Size | 1002 bp |
RefSeq ORF | 519 bp |
Locus ID | 68975 |
Cytogenetics | 2 19.84 cM |
Gene Summary | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks two 5' exons but instead contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228273 | Med27 (myc-DDK-tagged) - Mouse mediator complex subunit 27 (Med27), transcript variant 3 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review