Zfp740 (NM_001289691) Mouse Untagged Clone

CAT#: MC226041

Zfp740 (untagged) - Mouse zinc finger protein 740 (Zfp740), transcript variant 2


  "NM_001289691" in other vectors (1)

Reconstitution Protocol

USD 330.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Zfp740"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Zfp740
Synonyms 1110034O07Rik; AW548228; Znf740
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226041 representing NM_001289691
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGCTGAGCCAGATTGCCAGCAAGCAGGCTGAAAACGGCGAGCGGGCAGGTAGCCCTGATGTGCTGA
GGTGCTCCAGTCAGGGCCACCGAAAAGACAGTGATAAATCCCGCAACCGCAAAGAGGATGACAGCTTGGC
TGAGGCCTCTCATTCAAAAAAGACTGTTAAAAAGGTGGTGGTAGTGGAACAAAATGGCTCTTTTCAAGTA
AAGATTCCCAAAAATTTTATTTGTGAACACTGCTTTGGAGCCTTTCGGAGCAGTTACCACCTCAAGAGGC
ACGTCCTAATCCACACTGGTGAGAAACCATTTGAGTGTGATGTCTGTGATATGCGTTTCATCCAGAAGTA
CCATCTCGAACGCCACAAGCGGGTACACAGTGGCGAAAAGCCTTACCAGTGTGAACGATGTCATCAGTGT
TTTTCTCGGACAGACCGATTACTCAGACACAAACGGATGTGCCAAGGATGCCAGTCCAAGACTTCTGAAG
GGCAGTTTTCTCTATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289691
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289691.1, NP_001276620.1
RefSeq Size 4249 bp
RefSeq ORF 507 bp
Locus ID 68744
UniProt ID Q6NZQ6
Cytogenetics 15 F2-F3
Gene Summary May be involved in transcriptional regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and has multiple differences in the 5' coding region compared to variant 1. These differences cause translation initiation at a downstream start codon compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.