Ddit3 (NM_001290183) Mouse Untagged Clone
CAT#: MC226040
Ddit3 (untagged) - Mouse DNA-damage inducible transcript 3 (Ddit3), transcript variant 2
"NM_001290183" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ddit3 |
Synonyms | chop; CHOP-10; CHOP10; gadd153 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226040 representing NM_001290183
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGG ATCTGCAGGAGGTCCTGTCCTCAGATGAAATTGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGA AGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACA GAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAG AGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCA ACGCATGAAGGAGAAGGAGCAGGAGAACGAGCGGAAAGTGGCACAGCTAGCTGAAGAGAACGAGCGGCTC AAGCAGGAAATCGAGCGCCTGACCAGGGAGGTGGAGACCACACGGCGGGCTCTGATCGACCGCATGGTCA GCCTGCACCAAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290183 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001290183.1, NP_001277112.1 |
RefSeq Size | 840 bp |
RefSeq ORF | 507 bp |
Locus ID | 13198 |
UniProt ID | P35639 |
Cytogenetics | 10 D3 |
Gene Summary | Multifunctional transcription factor in ER stress response. Plays an essential role in the response to a wide variety of cell stresses and induces cell cycle arrest and apoptosis in response to ER stress. Plays a dual role both as an inhibitor of CCAAT/enhancer-binding protein (C/EBP) function and as an activator of other genes. Acts as a dominant-negative regulator of C/EBP-induced transcription: dimerizes with members of the C/EBP family, impairs their association with C/EBP binding sites in the promoter regions, and inhibits the expression of C/EBP regulated genes. Positively regulates the transcription of TRIB3, IL6, IL8, IL23, TNFRSF10B/DR5, PPP1R15A/GADD34, BBC3/PUMA, BCL2L11/BIM and ERO1L. Negatively regulates; expression of BCL2 and MYOD1, ATF4-dependent transcriptional activation of asparagine synthetase (ASNS), CEBPA-dependent transcriptional activation of hepcidin (HAMP) and CEBPB-mediated expression of peroxisome proliferator-activated receptor gamma (PPARG). Inhibits the canonical Wnt signaling pathway by binding to TCF7L2/TCF4, impairing its DNA-binding properties and repressing its transcriptional activity. Plays a regulatory role in the inflammatory response through the induction of caspase-11 (CASP4/CASP11) which induces the activation of caspase-1 (CASP1) and both these caspases increase the activation of pro-IL1B to mature IL1B which is involved in the inflammatory response. Acts as a major regulator of postnatal neovascularization through regulation of endothelial nitric oxide synthase (NOS3)-related signaling.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an internal exon in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228251 | Ddit3 (myc-DDK-tagged) - Mouse DNA-damage inducible transcript 3 (Ddit3), transcript variant 2 |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review