Timm22 (NM_001291161) Mouse Untagged Clone

CAT#: MC225877

Timm22 (untagged) - Mouse translocase of inner mitochondrial membrane 22 (Timm22), transcript variant 3

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Timm22
• Synonyms: Tim22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC225877 representing NM_001291161
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCATAGGCAGACTTTGCTTCTACACCTTCTTCAGTGTGGCGAATCTGCCGTTGTCGTCACTCTGGCTG
  GACGCCTAGGGTTTGTCTTGGGAGGCGCGTTTGGTATCTTTACTGCTGGCATTGATACCAACGTAGGCTT
  TGACCCAAAGGACCCTTACCGGACACCAACTGCAAAAGAAGTCCTGAAAGACATGGGACAGAGAGGAATG
  TCCTATGCCAAAAACTTTGCCATTGTGGGCGCCATGTTTTCATGTACTGAGTGTCTGGTAGAGTCTTACC
  GGGGAAAGTCGGACTGGAAGAACAGCGTCATCAGTGGCTGCATCACTGGCGGAGCCATCGGCTTCCGAGC
  TGGAGTAAAGGCCGGGGCCATAGGTTGTGGAGGGTTTGCTGCTTTCTCTGCTGCAATCGATTATTACCTA
  CGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291161
• Insert Size: 426 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291161.1, NP_001278090.1
• RefSeq Size: 2757 bp
• RefSeq ORF: 426 bp
• Locus ID: 56322
• UniProt ID: Q9CQ85
• Cytogenetics: 11 B5
• Gene Summary: Essential core component of the TIM22 complex, a complex that mediates the import and insertion of multi-pass transmembrane proteins into the mitochondrial inner membrane. In the TIM22 complex, it constitutes the voltage-activated and signal-gated channel. Forms a twin-pore translocase that uses the membrane potential as external driving force in 2 voltage-dependent steps (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks part of the 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (3) has a shorter and distinct N-terminus, compared to isoform 1.