Nbdy (NM_027327) Mouse Untagged Clone
CAT#: MC225479
2210013O21Rik (untagged) - Mouse RIKEN cDNA 2210013O21 gene (2210013O21Rik)
"NM_027327" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nbdy |
Synonyms | 2210013O21Rik; AI181827; Thp5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225479 representing NM_027327
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTAAAGGCTCATCTTATATTTTCTACCCCATTGACCATTTCTCTATTTGACTGTGCCACTTGGAGAC CGTATTTACAAACTGAGTATTATGATGTAATGACTGTGATTTCACCTCCAGAATTTGGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_027327 |
Insert Size | 132 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_027327.1, NP_081603.1 |
RefSeq Size | 856 bp |
RefSeq ORF | 132 bp |
Locus ID | 70123 |
Cytogenetics | X F3 |
Gene Summary | The protein encoded by this gene is a 43 aa peptide produced by early activated CD4+ T cells. The encoded protein helps regulate the differentiation of these cells into T helper 2 (Th2) cells. The solution structure of this protein is similar to that of vasoactive intestinal peptide, which plays a role in the differentiation of Th2 cells and Treg cells. [provided by RefSeq, Jun 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227690 | 2210013O21Rik (myc-DDK-tagged) - Mouse RIKEN cDNA 2210013O21 gene (2210013O21Rik) |
USD 165.00 |
{0} Product Review(s)
Be the first one to submit a review