Dus3l (NM_144858) Mouse Untagged Clone

CAT#: MC220035

Dus3l (untagged) - Mouse dihydrouridine synthase 3-like (S. cerevisiae) (Dus3l), (10ug)

USD 814.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Dus3l (NM_144858) Mouse Untagged Clone
Symbol Dus3l
Synonyms AI662135; AW557805
Vector pCMV6-Entry
Sequence Data
>MC220035 representing NM_144858
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGACGGCAGCGGAGAGCGGTGGTGGCGGTGACTCCGGGGTTGGCGCGTGCGAACGGGGGGTGG
CGCCCATTAAAGCTCAGTACCGCACAACCAAAGAACGGTTCCACGAATATCTGGATGGAGACAAGCAGGA
GGGTGCATGCCAGGAAGTGCCCACAGGAGACCCAGCTGAGCCAGGGGCCAAAAGAATTCGCCTGGAAGAT
GGGCAGGAAAATGGGAAGACAGAGGTGGCAATTGAATCCCGTGAAAGGCAGGTGCCCAAGAGGGCCCGTG
GCCAAAACAAAAGCCGGCCCCATGTGAAGCCAGCACACTACGACAAGGACAGGCTCTGCCCGTCCTTCCT
CCAGGAGCCGGCCACCCCATGTGCATTTGGAGACCGTTGCCGCTTCCTGCACGATGTGGGGCGCTACCTG
GAGACCAAACCGGCAGACCTGGGCCCCCGCTGCGTGCTCTTCGAAACCTTTGGCCGGTGCCCTTTCAGCA
TGACCTGTCGCTTTGCTGGAGCACACCTGGGGCCTGAGGGGCAGAACCTGGTGCAGGAAGAGGTGGTGGC
CCGCTGTGCACAGCTCCCTTCAGTGCGGAATGGCTTAGACAGGGCCCTGCAGCAGCAGCTGCGGAAGCGC
CAAGTGTGCTTTGAGCGAGCTGAGCAGGCCCTGAACCGCCTCACCCAGAGCCCCATGCCCACTGTTGTCC
CTGAGACCACTGTGGCCATGGCGACCCCAAAGCAGAATAGCTGCCATGCCCAGCTAGATACCGTAGGAGG
GGCTGGCACCCCGCAGAGCAGCCCTGTGCCAACCTGTGGCCCCTTGACAGACGAGGACGTGATCCGGCTG
CGGCCCTGTGAGAAGAAGCGGCTAGACATCAGCGGAAAGCTGTATCTGGCTCCTTTAACCACGTGTGGAA
ACCTACCCTTTCGCCGCATTTGCAAGCGCTTTGGCGCGGATGTGACCTGCGGTGAGATGGCCGTGTGTAC
GAACCTGCTCCAGGGACAGATGTCTGAGTGGGCTTTGCTCAAGCGCCACCCCTGTGAGGACATCTTTGGG
GTGCAGCTGGAGGGCGCGTTCCCTGACACCATGACCAAATGTGCCGAGCTCCTCAACCGCACCATTGACG
TGGACTTCGTGGACATCAACGTGGGCTGCCCCATCGACCTCGTCTACAAGAAGGGTGGTGGCTGTGCACT
CATGAATCGCTCCGCCAAGTTCCAACAGATTGTGCGGGGCGTGAATGAGGTGTTGGACGTCCCACTGACT
GTGAAGATGCGCACAGGTGTCCAGGAGCGTGTGAGCCTGGCACACCGACTGCTGCCCGAACTGCGGGACT
GGGGTGTCGCACTGGTCACGCTCCATGGCCGCTCCCGGGAACAGCGCTACACCAGGCTGGCTGACTGGCC
CTACATAGAACAGTGTGCCAAGGTGGCCAGCCCCATGCCCCTGTTTGGAAATGGGGACATCCTTTCGTTT
GAGGACGCCAACTGTGCCATGCAGACAGGCGTTGCGGGGATCATGGTTGCCCGTGGTGCCTTGCTCAAGC
CCTGGCTGTTCACGGAGATCAAAGAACAGAGGCACTGGGACATCTCGTCCTCCGAGCGCCTGGACATCCT
GAGGGACTTCACTCACTACGGTTTAGAACACTGGGGCTCCGACACACAGGGCGTGGAGCGGACCCGGCGC
TTCCTGCTTGAGTGGCTCTCTTTTCTTTGCAGGTATGTGCCCGTGGGCCTGCTCGAGCGACCCCCACAGA
GGATCAATGAGAGGCCACCCTATTACTTAGGCCGTGACTACCTGGAGACACTGATGGCCAGCCAGCAGGC
TGCAGACTGGATTCGCATCAGTGAGATGCTGCTTGGACCAGTACCTCCTGGCTTCGTCTTCCTGCCCAAG
CACAAGGCCAATGCCTACAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_144858
ORF Size 1914 bp
Insert Size 1914
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_144858.2, NP_659107
RefSeq Size 2321
RefSeq ORF 1914
Locus ID 224907
Cytogenetics 17|17 D
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.