Cuzd1 (NM_008411) Mouse Untagged Clone

CAT#: MC219609

Cuzd1 (untagged) - Mouse CUB and zona pellucida-like domains 1 (Cuzd1), (10ug)

USD 773.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cuzd1 (NM_008411) Mouse Untagged Clone
Symbol Cuzd1
Synonyms Erg-1; Itmap1; Uo-44; Usg; Utczp
Vector pCMV6-Entry
Sequence Data
>MC219609 representing NM_008411
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGTCACTGGAAGGCTGTTCATCTGGGCTATTTTAGCTGTCTCCTGTGGGGCACAGCTGAATTCTA
CAGAGGCTGAAGGCAAATCAAGATGCACAGCCAGTCTGGGAGGGGCCAATCTGGGAGAGACCCATAAAGC
CCTGGTCCTACAGCTCAGTGCGAATGAGAACTGCACTTGGACCATAGAGAGACCTGAAAACAGGAGCATC
AGAATCATCTTCTCCTACATCAAGTTGGATCCAGGCAGCAGGTGTGAAACTGAAAACATTAAGGTGTTTG
ATGGAAGCTCCACCAGTGGGCCTCTGCTAGGGAAGGCCTGCAGCAGAAATGATTTCGTGCCTGTGTTTGA
ATCATCATCCAACTCGATGACATTTCAGATAGTCACTGGCTTGACAAAGTTCCCAAGGAGTGTCTTTATC
TTCTACTATTTTTTCTCCGCTGCTACCGTTATTCCAAACTGCGGTGGTGACCTGCGAGCATTGGAAGGGT
CCTTCAGCAGCCCCAATTATCCAAAGCCGCACCCTGAGCTGGCATATTGTGTCTGGCACATACAAGTGGG
GAAAGGCTATAAGATACAATTGAAGTTTACAGATCTCTTACTAGAGATGGATGAAAACTGCAAGTTTGAT
TTCATCGCAGTCTACGATGGCCCCTCCACCACGGCAGGCCTGCTCAAACAACTCTGCGGCCGTGGGAAGC
CTACCTTAGAATCTTCCTCTGACGCCATGACTGTCGTGCTATCTACAGATTATGCCAATTCCTACAAAGG
CTTTTCTGCTTCCTACACTTCAATTTACATCCACGATGTCAACACTACATCTCTAAGTTGTGTTTCTGAC
AAGATGAGAGTCATCATAAGCAAATCATACCTACCGGCACTCAACTACAATGAGAGCAATTTGCAGCTAA
ATGACCCAACTTGCAGACCGAATGTATCAAATGTCATAGAGTTCTCTATCCCTCTGCACGAATGCGGTAC
AGTCAAAAAGATAGAGGACCACGCGATCAGCTATACCAACAGGATCACCTTCATCGAGTCTCCGGTCTCT
GCTGTGATCACCCGACAGAAGCTCCTCCAGATCGTGGTGACCTGTGAGATGGAGTATAACTCTACCGTGG
AGATTATGTACATAACTGAAGACGACATCATACAGAACCAGAGTGTCCTGGGCAAATACAACACCAGCCT
GGCTCTCTATGAGTCCGACTCATTTGAAAACCTCGTACAGGAGTCACCATATTATGTAGACTTGAACCAG
ACTCTCTTTGTCCAAGCCACCTTGCACACCTCGGATCCAAGCCTGGTGGTGTTTCTGGATACTTGCAGAG
CCTCGCCTACGTCTGACTTTGCATCTCCAACCTACGACTTAATCAGCAGCGGATGTTGTCAAGATGAGAC
CTGTAAGGTGTATCCCTTATTTGGGCACTATGGAAGGTTCCAGTTTAATGCCTTTAAATTCTTGAAACAT
CTCAACTCTGTGTATCTCAAGTGTAAGATTTTGATATGTGATAACAATGACCAAACATCTCGCTGCAATC
AAGGCTGTGTCCCAAGAAGGAAACGGGATATTCCTTCCTACAAATGGAAGACTGACTCTGTTATAGGACC
CATTCGCCTGAAGAGGGACCGAAGTGCAAGTAGAGATTCAGGACTTCTGCCTCAAATACATGAAGCAGAA
ATTTCAAACCAGCCCCTCAGTCGCCTGTACCTGTTTTCCTTCATGGTTCTTGCGCTAAATGTGGTGATTG
TGGCGATAACCACAGTGAAGCATTTCCTAAATCGGTGGATGGATCACAGATACCAGAAGCTGCAGGTCTA
CTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_008411
ORF Size 1824 bp
Insert Size 1824
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_008411.3, NP_032437
RefSeq Size 2270
RefSeq ORF 1824
Locus ID 16433
Cytogenetics 7|7 F3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.