Cblc (NM_001161844) Mouse Untagged Clone

CAT#: MC218504

Cblc (untagged) - Mouse Casitas B-lineage lymphoma c (Cblc), transcript variant 2, (10ug)


  "NM_001161844" in other vectors (3)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Cblc"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Cblc
Synonyms 2310076I21Rik; 2310079L19Rik; Cbl3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218504 representing NM_001161844
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCGGCGGCAGCCCCGCGAGGGTGGCAGCGGGGCGAGCCACGCGCGCTTAGCCGGGCGGTGAAGT
TGCTCCAGCGCCTAGAAGAGCAATGCAGGGATCCCAGGATGGTCACGGGGCCCCCGTCCCTGCGGGACCT
GCTGCCCCGCACCGCGCAGCTACTTGGAGAGGTGGCAAAGGCCCGGCGCGAGGCCAGGGAAGACCCCGAG
GGTCCCGGTGGCGCCGATGACTTTCTGGCCATCTACCTGGCCAATCTGGAGGTCAAAGGCAGGCAGGTGG
CGGAGCTCCTGCCACCCCGAGGCAAAAAGGACGTGAACCAGGATGTTTTCCGGGAGGGCTCCAGATTCAG
GCGACAACTGGCCAAGCTGGCCCTCATCTTCAGTCACATGCACGCGGAGTTGAGCGCACTCTTCCCTGCT
GGGAAGTACTGTGGGCACCTGTACCAGCTCACCAAGGGCTCTGCCCACATCTTCTGGAGGCAGAATTGTG
GAGTTCGGTGCGTGCTTCCCTGGGCTGAGTTCCAGTCCCTCCTGTGTGCCTGCCACCCTGTGGAACCAGG
CCCCACCATGCAGGCCTTGCGGTCCACCTTGGACCTCACCTGTAACGGCCACGTGTCTGTCTTTGAGTTT
GACGTCTTCACCAGGCTCTTTCAGCCGTGGCCCACTTTACTGAGGAATTGGCAACTCCTGGCTGTCAACC
ATCCTGGCTACATGGCCTTCCTCACCTACGATGAGGTCCAAACACGCCTGCAGGCCTACAGGGACAAACC
AGGCAGCTATATCTTCCGGCCAAGCTGTACCCGCCTGGGGCAGTGGGCCATTGGATACGTGAGCTCCGAT
GGAAGCATCCTGCAAACCATTCCTCTCAACAAACCTCTGCTGCAGGTGCTCCTGAAGGGACAAAAGGACG
GCATCTTCCTCTTCCCTGATGGAAAGAAACACAACCCAGACCTGACTGAGCTCTGCCGGGTAGAACCCTA
CCAACGCATCCAAGTGTCAGAGGACTCAGACAGCCAGACCTGTCCCTTCTGCCGTTGTGAGATCAAAGGT
CGAGAGGCCGTGAGTATCTGTCAGGCACAGGAGAGGCCAACGGAGGTCAGGACTGCTGCAGATGGCTCAA
GAGACAACTGTCACCAGGAGGCTGCTGAGCAGAAACTGGGGCCGGTGATTCCCTCTGCTCCCTCACTACT
CCCTGAAGATCAGTTCCCTCAGGGACCCCAAGACAAAGGCTGGCTGACACTGGCACCACTCGCCCTGCCC
AGGCTCCGACCTCCACTTCCTCTCCCCAAAATGGCCTCGGTTCTGTGGGAAGTCACCTCCAGGCCCCGGG
CCAGGGAGGAGGCCACAGAAAGCTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001161844
Insert Size 1359 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001161844.1, NP_001155316.1
RefSeq Size 1530 bp
RefSeq ORF 1359 bp
Locus ID 80794
Cytogenetics 7 A3
Gene Summary Acts as an E3 ubiquitin-protein ligase, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, and then transfers it to substrates promoting their degradation by the proteasome. Functionally coupled with the E2 ubiquitin-protein ligases UB2D1, UB2D2 and UB2D3. Regulator of EGFR mediated signal transduction; upon EGF activation, ubiquitinates EGFR. Isoform 1, but not isoform 2, inhibits EGF stimulated MAPK1 activation. Promotes ubiquitination of SRC phosphorylated at 'Tyr-424', has the highest ubiquitin ligase activity among CBL family proteins. In collaboration with CD2AP may act as regulatory checkpoint for Ret signaling by modulating the rate of RET degradation after ligand activation; CD2AP converts it from an inhibitor to a promoter of RET degradation; the function limits the potency of GDNF on neuronal survival.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.