Ywhaq (BC106164) Mouse Untagged Clone

CAT#: MC218272

Ywhaq (untagged) - Mouse tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide (cDNA clone MGC:118161, (10ug)


  "BC106164" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Ywhaq"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ywhaq
Synonyms 14-3-3theta, RP23-402H11.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC106164
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAAGACCGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCA
CCTGCATGAAAGCCGTGACGGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTGTCGGTGGC
CTACAAAAACGTGGTAGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCGAGCATTGAGCAGAAGACCGAC
ACCTCTGACAAGAAGTTGCAGCTGATCAAGGACTATCGGGAGAAAGTGGAGTCGGAGCTGAGGTCCATCT
GCACCACGGTCCTGGAATTGTTGGATAAGTATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTT
CTATCTGAAAATGAAGGGAGATTATTTCCGGTATCTTGCTGAAGTAGCTTGTGGCGATGATCGAAAACAA
ACAATAGAAAATTCCCAAGGAGCCTACCAAGAGGCGTTTGATATAAGCAAGAAGGAGATGCAGCCTACGC
ATCCAATCCGCCTGGGGCTGGCTCTTAACTTTTCTGTATTTTACTATGAGATCCTTAATAATCCAGAGCT
TGCCTGCACACTGGCTAAAACGGCTTTTGATGAGGCCATCGCAGAGCTTGATACACTGAACGAAGACTCC
TACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACTTAACATTATGGACATCAGACAGTGCAG
GAGAAGAATGTGATGCAGCAGAGGGGGCCGAAAACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC106164
Insert Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC106164, AAI06165
RefSeq Size 1492 bp
RefSeq ORF 737 bp
Locus ID 22630
Cytogenetics 12 A1.3
Gene Summary Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. Negatively regulates the kinase activity of PDPK1 (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.