Sufu (NM_001025391) Mouse Untagged Clone

CAT#: MC216599

Sufu (untagged) - Mouse suppressor of fused homolog (Drosophila) (Sufu), transcript variant 2, (10ug)


  "NM_001025391" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sufu"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sufu
Synonyms Su(fu)
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216599 representing NM_001025391
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGCTGCGGCCTAGCGTCGCCCCCGGTCCCGCCGCGCCCCCGGCCTCTGGCCCTAGTGCCCCTC
CGGCCTTTGCTTCACTCTTTCCCCCGGGACTGCACGCCATCTACGGAGAGTGTCGCCGCCTCTACCCTGA
CCAGCCGAACCCGCTCCAGGTTACCGCTATCGTCAAGTACTGGTTGGGTGGTCCGGACCCCTTGGACTAT
GTTAGCATGTACAGGAACATGGGGAGTCCTTCTGCCAACATCCCTGAGCACTGGCACTACATCAGCTTTG
GCCTGAGTGATCTCTATGGTGACAACAGAGTCCATGAGTTTACAGGAACAGACGGACCAAGTGGATTTGG
CTTTGAGTTGACGTTTCGTCTGAAGAGAGAAACTGGGGAGTCTGCCCCACCAACATGGCCAGCAGAGCTG
ATGCAGGGCCTAGCCCGATATGTCTTCCAGTCAGAGAACACCTTCTGTAGCGGGGACCATGTGTCTTGGC
ACAGCCCTTTGGATAACAGTGAGTCAAGAATTCAGCACATGCTGCTGACGGAGGACCCACAGATGCAGCC
TGTGCGGACACCCTTTGGGGTAGTGACTTTCCTCCAGATTGTTGGTGTCTGCACTGAGGAGTTACATTCA
GCCCAACAGTGGAACGGGCAGGGCATCCTGGAACTACTACGGACAGTGCCCATTGCTGGCGGTCCCTGGC
TGATAACTGACATGCGGCGGGGAGAAACCATATTTGAGATCGATCCGCACCTGCAAGAGAGAGTTGACAA
AGGCATTGAGACAGACGGTTCTAACCTGAGCGGCGTCAGTGCCAAGTGTGCCTGGGATGACCTCAGCCGG
CCTCCGGAGGATGAAGAGGATAGCCGGAGCATCTGCCTCGGCACACAGCCTCGGAGGCTGTCTGGCAAAG
ACACAGAGCAGATCCGGGAGACCCTGAGGCGGGGACTGGAGATTAACAGCAAACCTGTCCTTCCACCAAT
CAATTCTCAGCGACAGAACGGCCTCACCCACGACAGGGCTCCGAGCCGCAAGGACAGTTTGGGCAGCGAC
AGCTCCACGGCCATCATCCCCCACGAGCTGATCCGCACACGGCAGCTCGAGAGCGTGCATCTAAAATTTA
ACCAAGAGTCGGGAGCCCTCATCCCTCTCTGCCTAAGGGGCAGACTCCTACATGGCCGGCACTTCACCTA
CAAGAGTATCACAGGCGACATGGCCATCACGTTTGTGTCCACGGGAGTGGAAGGCGCCTTTGCCACTGAG
GAACACCCGTATGCAGCTCACGGACCCTGGTTACAAATTCTGTTGACAGAAGAGTTTGTAGAGAAGATGT
TGGAGGACTTAGAAGATCTAACCTCTCCAGAGGAATTTAAACTTCCCAAAGAGTACAGCTGGCCTGAGAA
GAAACTCAAAGTGTCCATTCTCCCCGACGTGGTGTTCGACAGTCCACTGCACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001025391
Insert Size 1455 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025391.2, NP_001020562.1
RefSeq Size 4522 bp
RefSeq ORF 1455 bp
Locus ID 24069
UniProt ID Q9Z0P7
Cytogenetics 19 38.85 cM
Gene Summary Negative regulator in the hedgehog/smoothened signaling pathway (PubMed:16155214, PubMed:16459298). Down-regulates GLI1-mediated transactivation of target genes (PubMed:11960000). Part of a corepressor complex that acts on DNA-bound GLI1 (PubMed:11960000). May also act by linking GLI1 to BTRC and thereby targeting GLI1 to degradation by the proteasome (By similarity). Sequesters GLI1, GLI2 and GLI3 in the cytoplasm, this effect is overcome by binding of STK36 to both SUFU and a GLI protein (PubMed:10531011, PubMed:16459298). Negative regulator of beta-catenin signaling (PubMed:11477086). Regulates the formation of either the repressor form (GLI3R) or the activator form (GLI3A) of the full-length form of GLI3 (GLI3FL) (PubMed:10531011, PubMed:20360384). GLI3FL is complexed with SUFU in the cytoplasm and is maintained in a neutral state (PubMed:10531011, PubMed:20360384). Without the Hh signal, the SUFU-GLI3 complex is recruited to cilia, leading to the efficient processing of GLI3FL into GLI3R (PubMed:10531011, PubMed:20360384). When Hh signaling is initiated, SUFU dissociates from GLI3FL and the latter translocates to the nucleus, where it is phosphorylated, destabilized, and converted to a transcriptional activator (GLI3A) (PubMed:10531011, PubMed:20360384). Required for normal embryonic development (PubMed:16155214, PubMed:16459298). Required for the proper formation of hair follicles and the control of epidermal differentiation (PubMed:16155214, PubMed:16459298, PubMed:23034632).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.