Rgs6 (NM_015812) Mouse Untagged Clone

CAT#: MC216490

Rgs6 (untagged) - Mouse regulator of G-protein signaling 6 (Rgs6), (10ug)


  "NM_015812" in other vectors (4)

Reconstitution Protocol

USD 503.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rgs6"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rgs6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216490 representing NM_015812
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTCAGGGGTCCGGGGACCAGCGAGCAGTGGGGATCGCTGATCCAGAAGAGAGTTCTCCCAACATGA
TTGTCTACTGCAAAATTGAGGACATCATTACAAAGATGCAAGATGACAAGACAGGGGGTGTGCCCATCAG
AACAGTTAAGAGCTTTCTCTCCAAAATCCCCAGTGTCGTCACAGGTACTGACATTGTACAGTGGCTTATG
AAGAACCTTTCCATTGAGGACCCAGTTGAAGCAATACACCTGGGAAGCCTTATTGCCGCCCAGGGCTACA
TCTTCCCAATCTCAGACCATGTTCTCACCATGAAGGACGATGGCACCTTTTACCGTTTCCAGGCTCCTTA
CTTCTGGCCTTCAAACTGCTGGGAACCTGAAAACACGGACTATGCCATCTATCTCTGTAAGAGGACGATG
CAGAACAAAGCAAGGCTGGAACTGGCCGACTACGAAGCAGAAAACTTAGCAAGACTCCAGAGGGCCTTTG
CAAGGAAGTGGGAATTCATCTTTATGCAAGCAGAAGCACAAGTGAAGATTGACCGGAAAAAGGATAAGAC
AGAAAGAAAAATTCTGGATAGCCAAGAACGGGCCTTCTGGGATGTCCACAGGCCAGTGCCAGGCTGTGTG
AACACAACAGAAATGGATATCAGAAAATGTCGGCGTTTGAAGAATCCACAAAAGGTTAAAAAGTCAGTAT
ATGGTGTGACAGACGAGACCCAGTCACAGAGTCCAGTGCACATACCAAGCCAGCCAATCAGGAAAACTAC
AAAAGATGACATCCGAAAACAGATAACGTTTTTGAATGCACAGATTGACAGACATTGTTTGAAAATGTCC
AAAGTGGCTGAAAGTTTAATCGCTTACACGGAGCAGTATGTGGAGTACGACCCATTCATAACACCAGCAG
AGCCATCTAATCCTTGGATCAGCGATGACATCACCTTATGGGACATAGAGATGAGCAAAGAGCCCAGCCA
GCAGCGAGTGAAGCGTTGGGGCTTCTCTTTTGATGAGATACTGAAGGACCAGGTGGGGCGGGACCAGTTC
CTCAGATTCCTGGAGTCAGAATTCAGCTCAGAAAATCTCAGGTTCTGGCTGTCTGTCCAAGATCTCAAGA
AGCAACCTCTACAGGACGTGGCCAAGAGGGTGGAGGAAATCTGGCAAGAGTTTCTAGCTCCCGGAGCCCC
AAGTGCAATCAACTTGGATTCTCACAGCTATGAGATAACCAGTCAGAATGTCAAAGATGGAGGGAGATAC
ACATTTGAAGATGCCCAGGAGCACATCTACAAGCTGATGAAGAGTGACAGCTATGCCCGCTTCCTACGGT
CCAACGCTTACCAGGATCTGTTGCTGGCCAAGAAGAAGGGAAAGTCGCTGGCGGGCAAGCGCCTTACGGG
CCTGATGCAGTCCTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_015812
Insert Size 1419 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_015812.4, NP_056627.1
RefSeq Size 5983 bp
RefSeq ORF 1419 bp
Locus ID 50779
UniProt ID Q9Z2H2
Cytogenetics 12 38.14 cM
Gene Summary This gene encodes a member of the RGS (regulator of G protein signaling) family of proteins, which are defined by the presence of a RGS domain that confers the GTPase-activating activity of these proteins toward certain G alpha subunits. This protein also belongs to a subfamily of RGS proteins characterized by the presence of DEP (Dishevelled, Egl-10, and Pleckstrin) and GGL (G-protein gamma like)domains, the latter a G beta 5-interacting domain. The RGS proteins negatively regulate G protein signaling, and may modulate neuronal, cardiovascular, lymphocytic activities, and cancer risk. Mice lacking this gene exhibit decreased heart rate. Alternative splicing results in multiple transcript variants, however, the full-length nature of some of these variants is not known. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 3' coding region, compared to variant 3. Variants 1 and 2 encode the same isoform (2), which is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.