Gm8693 (NM_001167154) Mouse Untagged Clone

CAT#: MC215410

Gm8693 (untagged) - Mouse predicted gene 8693 (Gm8693), (10ug)

USD 402.00


Availability*
3 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gm8693 (NM_001167154) Mouse Untagged Clone
Symbol Gm8693
Synonyms 100042980; EG667543; Gm4144; Vmn1r108; Vmn1r156
Vector pCMV6-Entry
Sequence Data
>MC215410 representing NM_001167154
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTTCATGATAAATCCGTGAAAACCACTGAGGAAGTGGCTCTTCAGCTCCTCTTGCTTTGCCAGT
TTGGGGTTGGGACTGTGGCCAATGTCTTTCTGTTTGTCCATAATTTCTCTCCAGTCTTGACTGGTTATAA
ACAGAGACCCAGACAGGTGATTTTAAGCCACATGGCTGTGGCCAATGCCTTGACTCTATTCCTCACTATA
TTTCCAAACAACATGATGGCTTTTGCTCCCAAAACTCCTCCAAATGAACTCAAATGTAAATTAGAATCCT
TCAGTCGCCTGGTGGCAAGAAGCACAAACTTGTGTTCCACCTGTGTCCTGAGTATCCATCAGTTTGTCAC
TCTTTTTCCTCTTAGTAGAGGTAAAGGTAAACTTATACTCAGAGCAAGTGTCCAAAATTTGGCGAGTTAT
TCTTGTTACAGTTGTTGGTTTTTCAGTGTCTTAAGTAACATCCACATTCCAATTAAGGTCACTGGTCCAC
AGATAACAGACAATAACACTGACTCTAAAAGCAACTTGTTCTGTTCCACTTCTGGATTCATTGTAGGTAT
TGTCTTGCAGTTTGCCCATGATGCCACATTCATGAGCATCATGATCTGGACCAGTGTCTCCATGATACTT
CTCCTCCATAGACATTGCCAGCGAATGCAGGACATCCTCACTCCCAATCAGAACCCTAGAGGCCAAGCTG
AGACCAGAGCAACCCGTACTATCTTGATGCTGGTGGTCACATTTGTTAGCTTTTATCTTCTAAATTGTAT
TTGTATCATCTTTCATGCCTTTTTTATACATTCTCGTCTCTTCATAAGGCTTGTCAGTGAGGTTCTGGCT
GCAGTCTTCCCCAGTATCTGCCCCTTACTGTTGATCTTCAGAGATCCTAAAGATCCTTGTTCTGTGCTCT
TCAAATGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001167154
ORF Size 921 bp
Insert Size 921
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001167154.1, NP_001160626
RefSeq Size 921
RefSeq ORF 921
Locus ID 667543
Cytogenetics 7|7 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.