Hdac11 (NM_144919) Mouse Untagged Clone

CAT#: MC212939

Hdac11 (untagged) - Mouse histone deacetylase 11 (Hdac11), (10ug)


  "NM_144919" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Hdac11"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Hdac11
Synonyms MGC27683
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212939 representing NM_144919
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTCACGCAACACAGCTGTACCAGCATGTACCAGAGAAACGCTGGCCCATCGTGTACTCACCACGTT
ACAACATCACCTTCATGGGCCTGGAGAAGCTGCACCCCTTTGATGCTGGGAAATGGGGCAAGGTGATCAA
CTTCCTGAAAGAAGAGAAGCTGCTGTCCGATGGCATGCTGGTGGAGGCTCGGGAGGCCTCGGAGGAGGAC
CTGCTGGTGGTGCACACGAGGCGCTATCTCAACGAGCTGAAGTGGTCCTTTGTGGTGGCTACCATCACTG
AGATCCCCCCGGTCATCTTTCTTCCCAACTTCCTTGTGCAGAGGAAGGTGCTGAGGCCCCTGCGGACCCA
GACTGGAGGCACCATCATGGCAGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAATGTTGGTGGTGGC
TTCCACCACTGCTCCAGTGACCGTGGTGGGGGCTTCTGTGCCTATGCAGACATCACACTGGCTATCAAGT
TCCTGTTTGAACGCGTGGAAGGCATCTCCAGAGCCACCATCATTGATCTCGATGCCCACCAGGGCAATGG
GCATGAGCGAGACTTCATGGGTGACAAGCGAGTATACATCATGGATGTTTACAACCGCCACATCTACCCT
GGGGATCGCTTTGCTAAAGAGGCCATCAGGCGGAAGGTGGAATTGGAGTGGGGCACAGAAGATGAGGAAT
ATCTGGAGAAGGTGGAGAGGAATGTCAGGAGGTCCCTCCAGGAGCACCTGCCTGACGTGGTGGTGTACAA
CGCTGGCACGGACGTGCTGGAGGGAGACCGCCTCGGGGGGCTGTCCATCAGCCCAGCGGGCATTGTGAAG
AGGGATGAAGTGGTTTTCCGCGTGGTCCGAGCCCATGATATACCCATCCTCATGGTGACCTCGGGTGGGT
ACCAGAAGCGCACAGCCCGTATTATCGCCGACTCCATCCTCAACTTGCATGACCTGGGGCTCATTGGGCC
TGAGTTTCCCTGCGTCTCGGCACAGAACTCGGGCATCCCCCTGCTTTCCTGTGCTGTGCCTTGAAGCGGA
CCG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-RsrII     
ACCN NM_144919
Insert Size 1053 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC016208, AAH16208
RefSeq Size 2494 bp
RefSeq ORF 1044 bp
Locus ID 232232
UniProt ID Q91WA3
Cytogenetics 6 D1
Gene Summary Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.