Dlgap4 (NM_001042488) Mouse Untagged Clone

CAT#: MC212834

Dlgap4 (untagged) - Mouse discs, large homolog-associated protein 4 (Drosophila) (Dlgap4), transcript variant 3, (10ug)


  "NM_001042488" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Dlgap4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Dlgap4
Synonyms AI225853; BC024558; DA; DAP-4; DAP4; S; SAPAP-4; Sapap4; WBP1; WBP16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212834 representing NM_001042488
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTCCCGTCGGGACACTGACTCTGATACCCAGGATGCCAACGACTCCAGTTGTAAGTCATCTGAGA
GGAGTCTCCCAGACTGTACCTCACACCCCAATTCCATCAGCATTGATGCTGGCCCCCGACAGGCCCCCAA
GATTGCCCAGATCAAGCGCAACCTCTCCTATGGAGACAACAGCGACCCTGCCCTGGAGGCGTCTTCGCTG
CCCCCACCCGACCCTTGGCTGGAGACTTCCTCCAGCTCCCCAGCAGAGCCCGCTCAGCCAGGGGCCTGCC
GCAGGGATGGCTACTGGTTCCTGAAGCTCCTTCAGGCAGAAACGGAGAGACTGGAAGGCTGGTGCTGCCA
GATGGACAAGGAGACCAAAGAGAACAACCTCTCTGAAGAAGTCTTAGGGAAAGTTCTCAGTGCTGTGGGC
AGCGCCCAGCTCCTGATGTCCCAGAAATTCCAGCAGTTCCGCGGCCTCTGTGAGCAGAACTTGAACCCTG
ATGCCAACCCCCGTCCGACAGCCCAGGACCTGGCAGGGTTCTGGGACCTGCTGCAGCTGTCCATTGAGGA
CATCAGCATGAAGTTCGATGAGCTCTACCACCTCAAGGCCAACAGCTGGCAGCTGGTGGAGACCCCCGAG
AAGAGGAAGGAAGAGAAGAAGCCACCCCCTCCAGTCCCGAAGAAGCCAGCCAAATCCAAGGCGGCAGTGA
GCCGCGACAAGGCCTCAGACGCGGGGGACAAGCAGCGTCAGGAGGCCAGAAAGAGACTCCTGGCCGCCAA
GCGAGCAGCGTCTGTGCGGCAGAACTCGGCCACAGAGAGTGCGGACAGCATCGAGATTTATGTCCCCGAG
GCCCAGACCAGGCTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001042488
Insert Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042488.2, NP_001035953.1
RefSeq Size 2930 bp
RefSeq ORF 858 bp
Locus ID 228836
UniProt ID B1AZP2
Cytogenetics 2 H1
Gene Summary This gene encodes a membrane-associated guanylate kinase found at the postsynaptic density in neuronal cells. The encoded protein may play a role in synapse organization and neuronal signalling. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks several 5' coding exons, and initiates translation at a downstream in-frame start codon, compared to variant 1. It represents use of an alternate promoter. The encoded isoform (c) has a shorter N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.