Mcu (NM_001033259) Mouse Untagged Clone

CAT#: MC212635

Mcu (untagged) - Mouse coiled-coil domain containing 109A (Ccdc109a), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Mcu
• Synonyms: 2010012O16Rik; AV064928; C10orf42; Ccdc109a; D130073L02Rik; Gm64
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC212635 representing NM_001033259
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033259
• Insert Size: 1053 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033259.3, NP_001028431.2
• RefSeq Size: 1423 bp
• RefSeq ORF: 1053 bp
• Locus ID: 215999
• UniProt ID: Q3UMR5
• Cytogenetics: 10 B4
• Gene Summary: Mitochondrial inner membrane calcium uniporter that mediates calcium uptake into mitochondria (PubMed:21685886, PubMed:23900286, PubMed:24212091). Constitutes the pore-forming and calcium-conducting subunit of the uniporter complex (uniplex) (By similarity). Activity is regulated by MICU1 and MICU2 (By similarity). At low Ca(2+) levels MCU activity is down-regulated by MICU1 and MICU2; at higher Ca(2+) levels MICU1 increases MCU activity (By similarity). Mitochondrial calcium homeostasis plays key roles in cellular physiology and regulates cell bioenergetics, cytoplasmic calcium signals and activation of cell death pathways (By similarity). Involved in buffering the amplitude of systolic calcium rises in cardiomyocytes (By similarity). While dispensable for baseline homeostatic cardiac function, acts as a key regulator of short-term mitochondrial calcium loading underlying a 'fight-or-flight' response during acute stress: acts by mediating a rapid increase of mitochondrial calcium in pacemaker cells (PubMed:26119742, PubMed:26119731, PubMed:25603276). Participates in mitochondrial permeability transition during ischemia-reperfusion injury (PubMed:26119731). Regulates glucose-dependent insulin secretion in pancreatic beta-cells by regulating mitochondrial calcium uptake (By similarity). Mitochondrial calcium uptake in skeletal muscle cells is involved in muscle size in adults (PubMed:25732818). Regulates synaptic vesicle endocytosis kinetics in central nerve terminal (PubMed:26644474). Involved in antigen processing and presentation (PubMed:25251370).[UniProtKB/Swiss-Prot Function]