Wdr82 (NM_029896) Mouse Untagged Clone

CAT#: MC211815

Wdr82 (untagged) - Mouse WD repeat domain containing 82 (Wdr82), (10ug)


  "NM_029896" in other vectors (4)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Wdr82"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Wdr82
Synonyms 9430077D24Rik; CDW5/WDR82
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211815 representing NM_029896
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGACCGACAGCGTGCTCCGGAGCTTCCGCGTCGCCAAGGTGTTCCGCGAGAACTCAGACAAGA
TCAACTGCTTTGACTTTAGTCCCAATGGCGAGACGGTCATCTCTAGCAGCGATGATGACTCCATCGTGCT
CTATGACTGCCAGGAGGGCAAACCAAAGAGAACCCTGTACAGTAAGAAGTACGGTGTGGACCTCATCAGA
TACACCCATGCAGCCAACACAGTCGTTTACAGCTCTAACAAAATAGACGATACTATTCGTTACTTGTCCT
TGCATGACAATAAATACATCAGATACTTTCCTGGACACAGCAAGAGGGTGGTGGCCTTGTCCATGTCACC
TGTGGATGACACTTTCATTTCTGGGTCTCTTGATAAGACCATTCGACTCTGGGATCTCCGGTCTCCTAAC
TGCCAGGGCCTCATGCATCTACAGGGCAAACCTGTCTGTTCCTTTGATCCAGAAGGGTTAATTTTTGCTG
CGGGCGTCAACTCAGAAATGGTCAAACTTTATGACCTTCGTTCTTTTGATAAGGGACCATTTGCAACATT
TAAGATGCAGTATGATAGGACCTGTGAGTGGACAGGACTTAAGTTCAGCAATGATGGCAAATTGATACTC
ATCTCCACCAACGGCAGCTTTATCCGACTGATTGACGCATTCAAGGGTGTGGTGATGCACACATTTGGGG
GTTATGCTAACAGCAAAGCTGTGACACTCGAAGCTTCATTTACTCCAGACTCACAGTTTATTATGATCGG
TTCGGAAGACGGCAAAATCCATGTCTGGAACGGAGAGAGTGGTATAAAAGTGGCTGTATTGGATGGCAAA
CACACTGGTCCCATTACCTGTTTGCAATTCAACCCCAAGTTTATGACCTTTGCCAGCGCCTGTTCCAACA
TGGCCTTCTGGTTGCCCACCATTGATGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_029896
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_029896.1, NP_084172.1
RefSeq Size 4313 bp
RefSeq ORF 942 bp
Locus ID 77305
UniProt ID Q8BFQ4
Cytogenetics 9 F1
Gene Summary Regulatory component of the SET1 complex implicated in the tethering of this complex to transcriptional start sites of active genes. Facilitates histone H3 'Lys-4' methylation via recruitment of the SETD1A or SETD1B to the 'Ser-5' phosphorylated C-terminal domain (CTD) of RNA polymerase II large subunit (POLR2A). Component of PTW/PP1 phosphatase complex, which plays a role in the control of chromatin structure and cell cycle progression during the transition from mitosis into interphase. Possible role in telomere length maintenance and in mRNA processing (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.