Rnase10 (NM_001162863) Mouse Untagged Clone

CAT#: MC211580

Rnase10 (untagged) - Mouse ribonuclease, RNase A family, 10 (non-active) (Rnase10), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rnase10
• Synonyms: 4930474F22Rik; Rah1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC211580 representing NM_001162863
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAAGGTGACACTGGTGCATCTGTTGTTCATGATGTTGCTGCTGTTGCTAGGCCTAGGGCTGGGGCTGG
  GCCTGGGCCTTCACATGGCAGCTGCCGTCCTGGAGGATCAGCCACTGAATGAATTTTGGCCCAGTGACTC
  CCAGAATACTGAAGAGGGAGAGGGCATCTGGACCACAGAAGGTCTGGCACTTGGCTACAAAGAAATGGCA
  CAACCTGTCTGGCCAGAAGAGGCTGTCCTCAGTGAAGATGAAGTGGGGGGAAGCAGGATGCTGAGGGCTG
  AGCCCCGCTTTCAGAGCAAACAAGACTACCTTAAGTTTGACTTGAGTGTCAGGGACTGTAATACCATGAT
  GGCACACAAGATAAAGGAGCCTAATCAGAGCTGCATAAACCAGTACACGTTCATCCATGAGGACCCAAAC
  ACAGTCAAAGCTGTCTGTAACGGTTCCCTGGTTGACTGTGACCTCAAGGGGGGCAAATGTTACAAAAGTC
  CCCGGCCTTTTGATCTGACATTGTGCAAATTGGCCAAACCAGGCCAAGTCACTCCCAACTGTCACTATCT
  GACTTACATAACCGAAAAGGTCATTTTCATGACATGCAATGACAAGAAACAACTGGAGACTAAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001162863
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001162863.1, NP_001156335.1
• RefSeq Size: 1521 bp
• RefSeq ORF: 627 bp
• Locus ID: 75019
• UniProt ID: Q9D5A9
• Cytogenetics: 14 C1
• Gene Summary: Secreted proximal epididymal protein required for post-testicular sperm maturation and male fertility. May be involved in sperm adhesion to the egg zona pellucida. Does not have ribonuclease activity.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.