Mrpl47 (NM_029017) Mouse Untagged Clone

CAT#: MC211540

Mrpl47 (untagged) - Mouse mitochondrial ribosomal protein L47 (Mrpl47), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_029017" in other vectors (4)

Reconstitution Protocol

USD 330.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Mrpl47"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Mrpl47
Synonyms 4833424P18Rik; CGI-20; CGI-204; Gm9859; L47mt; MRP-L47; MTF/L47; NCM; NCM1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211540 representing NM_029017
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCGACCAGTCTAGTGGGTATTTGTAGAAGAGCCTCAGCGTTCCTGAAGGCAGCTTGTTCCCTAG
TAAATCCCAAGGACGCTGCTCACTCGGGTTGCAGGTCTTCTCTTAGTTTGTTACATAAGAACACACCACA
TGTCACATCTTTTCTCCAGTGTAAATTACTTCATACCACGTTGTCAAGGAAAGGACTGGAAGAATTTTTT
GATGACCCAAAGAATTGGGGGGAAGAAAAAGTCAAATCTGGAGCTTCATGGACCTGCCAGCAGCTGAGGA
ACAAAAGTAACGAAGACTTACATAAGCTTTGGTATGTCCTTCTGAAGGAAAGAAACATGCTTCTAACTCT
GGAGCAGGAGGCCAAGCGACAGAGGTTGCCAATGCCAAGTCCGGAGCGCTTAGAAAAGGTCGTTGATTCC
ATGGATAACGTAGATAAAGTTGTCCAGGAGAGGGAAGATGCTCTAAGGCTTCTTCAGACCGGTCAAGAAA
AGCCCAGACCCGGTGCTTGGAGAAGGGACATCTTTGGACGAATTGTCTGGCACAAATTCAAGCAGTGGCC
TATACCTTGGTACCTAAATAAAAGATACAACAGGAGGCGGTTCTTCGCAATGCCTTATGTGGATCGCTTT
ATCAGACTAAGAATTGAGAAACACGCCCGCATTGAAGCAAGAAAGAGAAGTTTACAGAAAAAGAAAGAAA
AAATTCTCCATGCAAAGTTCCCACATCTCTCTCAAGAACGGAAATCAAGTAGTGTCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_029017
Insert Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_029017.2, NP_083293.1
RefSeq Size 899 bp
RefSeq ORF 759 bp
Locus ID 74600
UniProt ID Q8K2Y7
Cytogenetics 3 A3
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. This gene is immediately adjacent to the gene for BRG1/brm-associated factor 53A (also known as BAF complex 53 kDa subunit protein A in humans) in a tail-to-tail orientation. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.