2810006K23Rik (NM_028310) Mouse Untagged Clone
CAT#: MC211349
2810006K23Rik (untagged) - Mouse RIKEN cDNA 2810006K23 gene (2810006K23Rik), transcript variant 2, (10ug)
"NM_028310" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | 2810006K23Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211349 representing NM_028310
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTTCTAGGAGCACCTGGGCTCTGCTCCGCCTCCCTCTACCACTGATCAGGATATGCTCTGGGAAGT GGGGGCTCAGGCTTCAGGAGAAGCCAGCACTGCTCTTCCCAGGAATGGCTGCCAGCACAGTACAGGTGGC AGGCAGGAAGGACTACCCTGCTCTGCTCCCCCTGAATGAGAGTGAGCTCGAAGAACAGTTCGTGAAAGGA CATGGCCCAGGGGGCCAGGCCACCAACAAGACCAGCAATTGTGTAGTGCTCAAACACGTGCCCTCCGGCA TTGTGGTCAAGGTAGAGACGGGTGGGGAGCCCAGGTCTGCGGCCACAGCAGGTTTCAGCCAATGGGCATG CCCATTCTGGCACGGGGACACTGCCAACTCGGGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028310 |
Insert Size | 387 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_028310.3, NP_082586.1 |
RefSeq Size | 1636 bp |
RefSeq ORF | 387 bp |
Locus ID | 72650 |
UniProt ID | Q80VP5 |
Cytogenetics | 5 F |
Gene Summary | May act as a codon-independent translation release factor that has lost all stop codon specificity and directs the termination of translation in mitochondrion. May help rescuing stalled mitoribosomes during translation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate 3' terminal exon that extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. It encodes isoform b which is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222496 | 2810006K23Rik (tGFP-tagged) - Mouse RIKEN cDNA 2810006K23 gene (2810006K23Rik) transcript variant 2, (10ug) |
USD 365.00 |
|
MR222496 | 2810006K23Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2810006K23 gene (2810006K23Rik), transcript variant 2 |
USD 165.00 |
|
MR222496L3 | Lenti ORF clone of 2810006K23Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2810006K23 gene (2810006K23Rik), transcript variant 2 |
USD 465.00 |
|
MR222496L4 | Lenti ORF clone of 2810006K23Rik (mGFP-tagged) - Mouse RIKEN cDNA 2810006K23 gene (2810006K23Rik), transcript variant 2 |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review