Nupr1l (NM_026916) Mouse Untagged Clone
CAT#: MC210842
Nupr1l (untagged) - Mouse RIKEN cDNA 4930579G22 gene (4930579G22Rik), (10ug)
"NM_026916" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nupr1l |
Synonyms | 1810010E01Rik; 4930579G22Rik; Nupr2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210842 representing NM_026916
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACCCTCCAACTCGTCCTTCTGTCTCCGGCCCAAGGACTCGAGCCCGCCCGCCGCCGCCGGAGGCGC TGCCCACCGTCGGCTTCGAAGAGGAGGTGTACGACTGCCTGGATTACTACTACCTGCGTGACTTCCCGGC CTCTGGGGCTGGACGCAGCAAGGGCCGGACGCGGCGCGAGCAGCAGCTACGCACCAACTACCCGGTGCCC GGCGGCCACGAGCGCAAGGTGGCGCAGATACTGCTCAACGGGCAGCGCAAGCGGCGCCAGCGCCAGCTGC AACCGCGGCCGCGCACACGCCTGGCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026916 |
Insert Size | 309 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026916.3, NP_081192.2 |
RefSeq Size | 645 bp |
RefSeq ORF | 309 bp |
Locus ID | 69034 |
UniProt ID | Q497P3 |
Cytogenetics | 5 |
Gene Summary | Acts as a transcriptional repressor by inhibiting gene expression at the NUPR1 promoter in a p53/TP53-dependent manner in cancer cells. Involved in the G1 cell cycle arrest, and in a decrease in cell viability and cell proliferation of pancreatic cancer cells. Plays a role as a negative regulator of the protumoral factor NUPR1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG212440 | Nupr1l (tGFP-tagged) - Mouse RIKEN cDNA 4930579G22 gene (4930579G22Rik), (10ug) |
USD 350.00 |
|
MR212440 | Nupr1l (Myc-DDK-tagged) - Mouse RIKEN cDNA 4930579G22 gene (4930579G22Rik) |
USD 150.00 |
|
MR212440L3 | Lenti ORF clone of Nupr1l (Myc-DDK-tagged) - Mouse RIKEN cDNA 4930579G22 gene (4930579G22Rik) |
USD 450.00 |
|
MR212440L4 | Lenti ORF clone of Nupr1l (mGFP-tagged) - Mouse RIKEN cDNA 4930579G22 gene (4930579G22Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review