Pdlim7 (NM_001114087) Mouse Untagged Clone

CAT#: MC210546

Pdlim7 (untagged) - Mouse PDZ and LIM domain 7 (Pdlim7), transcript variant b, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Pdlim7
• Synonyms: LMP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210546 representing NM_001114087
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGATTCCTTCAAGGTGGTGCTGGAAGGGCCAGCCCCTTGGGGCTTCCGTCTGCAAGGGGGCAAGGACT
  TCAATGTGCCCCTCTCTATCTCTCGGCTCACGCCCGGAGGCAAAGCTGCACAGGCCGGTGTGGCTGTGGG
  AGACTGGGTACTGAATATTGACGGTGAGAACGCGGGCAGCCTCACGCACATCGAAGCCCAGAACAAGATC
  CGCGCCTGTGGGGAGCGCCTCAGCCTGGGTCTTAGCAGAGCCCAGCCTGTTCAGAGCAAACCACAGAAGG
  CCCTGACCCCTCCCGCCGACCCCCCGAGGTACACTTTTGCACCAAGCGCCTCCCTCAACAAGACGGCCCG
  GCCCTTCGGGGCACCCCCACCTACTGACAGCACCCTGCGGCAGAATGGACAGTTGCTCAGACAGCCGGTC
  CCCGATGCCAGCAAGCAGCGGCTGATGGAGGATACCGAAGACTGGCGGCCGCGGCCGGGGACAGGCCAGT
  CCCGCTCCTTCCGCATCCTTGCCCACCTCACGGGCACAGAGTTCATGCAAGACCCGGATGAGGAATTCAT
  GAAGAAGTCAAGGGAAAAGTATGTCCTGGAGCTACAGAGCCCACGCTATACACGTCTCCGGGACTGGCAC
  CACCAGCGCTCTGCCCACGTGCTCAACGTGCAGTCATAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001114087
• Insert Size: 669 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001114087.2, NP_001107559.1
• RefSeq Size: 1014 bp
• RefSeq ORF: 669 bp
• Locus ID: 67399
• Cytogenetics: 13 B1
• Gene Summary: May function as a scaffold on which the coordinated assembly of proteins can occur. May play a role as an adapter that, via its PDZ domain, localizes LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Involved in both of the two fundamental mechanisms of bone formation, direct bone formation (e.g. embryonic flat bones mandible and cranium), and endochondral bone formation (e.g. embryonic long bone development). Plays a role during fracture repair. Involved in BMP6 signaling pathway (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (b) lacks several exons, and uses an alternate 3'-terminal exon, compared to variant a. This results in a novel 3' coding region and 3' UTR, compared to variant a. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a.