Ccdc25 (NM_145944) Mouse Untagged Clone

CAT#: MC210501

Ccdc25 (untagged) - Mouse coiled-coil domain containing 25 (Ccdc25), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ccdc25
• Synonyms: 2610528H13Rik; NSrp70
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210501 representing NM_145944
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGTTCTACTTCACCAGCAGCAGCGTTAATTCATCTACTTACACTATTTACATGGGAAAGGATAAAT
  ATGAAAATGAAGATCTGATAAAGTATGGCTGGCCTGAAGATATTTGGTTTCACGTGGACAAACTCTCTTC
  GGCCCATGTGTACCTACGATTACAAAAGGGAGAGAAGATAGAAGACATTCCAAAGGAGGTTTTGATGGAC
  TGTGCCCACCTTGTGAAGGCCAATAGCATTCAAGGCTGCAAGATGAACAACGTTAATGTGGTTTACACGC
  CATGGTCTAACCTGAAGAAAACAGCTGACATGGATGTGGGGCAGATAGGCTTTCACAGGCAGAAGGATGT
  AAAGATTGTGACGGTAGAGAAGAAAGTGAATGAAATCTTGAACCGATTAGAAAAGACCAAACTGGAGAAG
  TTTCCAGACCTTGCAGCAGAGAAGGAAGGCAGAGACCGTGAAGAGAGGAATGAGAAGAAAGCCCAGATTC
  AGGAGATGAAAAGGAAAGAGAAAGAAGAAATGAAGAAGAAAAGGGAAATGGATGAACTTAGGAGCTACTC
  ATCACTCATGAAAGTTGAGAATATGTCCTCAAATCAAGATGGTAACGATTCCGATGAGTTCATGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_145944
• Insert Size: 627 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_145944.4, NP_666056.1
• RefSeq Size: 2228 bp
• RefSeq ORF: 627 bp
• Locus ID: 67179
• UniProt ID: Q78PG9
• Cytogenetics: 14 D1
• Gene Summary: Transmembrane receptor that senses neutrophil extracellular traps (NETs) and triggers the ILK-PARVB pathway to enhance cell motility. NETs are mainly composed of DNA fibers and are released by neutrophils to bind pathogens during inflammation (By similarity). Formation of NETs is also associated with cancer metastasis, NET-DNA acting as a chemotactic factor to attract cancer cells (By similarity). Specifically binds NETs on its extracellular region, in particular the 8-OHdG-enriched DNA present in NETs, and recruits ILK, initiating the ILK-PARVB cascade to induce cytoskeleton rearrangement and directional migration of cells (By similarity). In the context of cancer, promotes cancer metastasis by sensing NETs and promoting migration of tumor cells (By similarity).[UniProtKB/Swiss-Prot Function]