Trem3 (NM_021407) Mouse Untagged Clone

CAT#: MC210168

Trem3 (untagged) - Mouse triggering receptor expressed on myeloid cells 3 (Trem3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Trem3
• Synonyms: BB134760; TREM-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >MC210168 representing NM_021407
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGTCACCGCTGCTGCTATGGCTGGGGCTGATGCTCTGTGTCTCGGGACTCCAAGCTGGAGATGAGGAAG
  AACACAAGTGTTTTCTGGAGGGCGAGAACCTGACCCTGACTTGTCCTTACAACATCATGCTATACTCACT
  GAGCCTGAAGGCCTGGCAGCGGGTCAGAAGCCACGGTTCTCCAGAGACTCTGGTGCTCACAAACACCAGA
  AAGGCAGACTTCAACGTGGCCAGGGCTGGGAAGTACTTGCTGGAGGATTATCCCACCGAATCTGTCGTCA
  AGGTCACGGTGACTGGGCTGCAGAGGCAAGATGTGGGGCTGTACCAGTGTGTGGTCTACCTCTCTCCTGA
  CAATGTTATCATTCTGCGTCAACGGATACGGCTGGCATGGTGTCAAGGGAAGCCAGTGATGGTGATCGTT
  CTGACGTGTGGCTTCATACTAAACAAGGGCCTGGTCTTCTCAGTCCTGTTTGTCTTTCTCTGCAAAGCTG
  GGCCTAAGGTGTTACAGCCTTCCAAGACATCCAAAGTACAGGGAGTCTCTGAGAAACAGTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_021407
• Insert Size: 552 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_021407.3, NP_067382.1
• RefSeq Size: 1048 bp
• RefSeq ORF: 552 bp
• Locus ID: 58218
• UniProt ID: Q9JKE1
• Cytogenetics: 17 C
• Gene Summary: The protein encoded by this gene is part of the immunoglobulin and lectin-like superfamily and is thought to function as part of the innate immune system. This gene forms part of a cluster of genes on mouse chromosome 17 thought to be involved in innate immunity. This protein has been reported to associate with the adaptor protein Dap-12 to form a receptor signaling complex that activates myeloid cells. [provided by RefSeq, Jan 2013]