Noct (NM_009834) Mouse Untagged Clone

CAT#: MC208232

Ccrn4l (untagged) - Mouse CCR4 carbon catabolite repression 4-like (S. cerevisiae) (Ccrn4l), (10ug)


  "NM_009834" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Noct"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Noct
Synonyms AU043840; Ccr4; Ccrn4l
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208232 representing NM_009834
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTATCAGAGCCCGCGGCGGCTCTGCTCGGCCCTGCTGCTCAGGGACGCCCCCGGCCTGCGCCGCACAC
TCGTGCCCGGCCCGCGCCGAACGCTCGCCCCGCCGGTGCTCGGATCTCGGCCCAAGTCCCCGCAACTGCA
GGCGGCGGCGGCCTCGGGCGCCGCGAGGTCGCGTCCCCGAACAGTGAGTTCCATGGGAAACGGCACCAGT
CGACTCTACAGTGCTCTCGCCAAGACCGTCAACAGCAGTGCAGCTGCTCAGCACCCGGAGTACTTGGTGT
CAACTGACCCCGAACATCTGGAGCCCATCGATCCTAAGGAACTTCTGGAGGAATGCAGGGCTGTTCTGCA
CACTCGGCCACCCCGCTACCAGCGGGATTTTGTGGACCTGAGGACAGATTGCTCCAGCAGCCACTCTCCC
ATTCGCGTCATGCAGTGGAACATCCTCGCCCAAGCTCTCGGAGAAGGCAAAGACAACTTTGTGCAGTGCC
CCGTGGAAGCGCTCAAATGGGAAGAGAGGAAGTGCCTGATCCTGGAGGAGATCCTGGCTTACCAGCCAGA
CATACTGTGCCTCCAGGAAGTGGACCACTACTTTGACACCTTCCAGCCACTCCTCAGTAGACTGGGCTAC
CAAGGCACGTTTTTCCCCAAGCCCTGGTCACCATGTCTAGATGTGGAACACAACAACGGTCCAGATGGCT
GTGCCTTATTTTTTCTCCAAAACCGATTCAAGCTTATCAGCAGCACCAATATTAGGCTGACAGCCATGAC
CCTAAAAACCAATCAGGTGGCCATCGCACAGACCCTGGAGTGCAAGGAGTCTGGGCGACAGTTCTGCATT
GCTGTCACCCACTTAAAAGCCCGCACTGGCTGGGAGCGGTTCCGGTCAGCTCAGGGCTGTGACCTCCTCC
AGAACCTGCAGAACATCACCCAGGGAGCAAAGATCCCCCTGATCGTCTGCGGGGACTTCAACGCAGAGCC
AACCGAAGAGGTCTACAAACACTTTGCGTCCTCCAGCCTCAACCTCAACAGCGCCTACAAGCTGCTGAGT
CCCGATGGACAGTCGGAGCCTCCCTACACAACCTGGAAGATCCGGACCTCAGGCGAGTGTCGCCACACGC
TGGACTATATCTGGTACTCCAGACATGCTCTGAGTGTCACGTCCGCCCTGGATCTACTCACTGAAGAACA
GATTGGGCCCAACCGGCTCCCATCCTTCCATTACCCCTCGGACCACCTGTCCCTGGTGTGTGACTTCAGC
TTTAACGAGGAGCCCCATGAGCTCTTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009834
Insert Size 1290 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_009834.2, NP_033964.1
RefSeq Size 3069 bp
RefSeq ORF 1290 bp
Locus ID 12457
UniProt ID O35710
Cytogenetics 3 C
Gene Summary Represses translation and promotes degradation of target mRNA molecules (By similarity). Plays an important role in post-transcriptional regulation of metabolic genes under circadian control (PubMed:20685873, PubMed:20498072). May have low deadenylase activity and may degrade the poly(A) tails of specific target mRNAs, leading to their degradation and suppression of translation (PubMed:17400819). Exerts a rhythmic post-transcriptional control of genes necessary for metabolic functions including nutrient absorption, glucose/insulin sensitivity, lipid metabolism, adipogenesis, inflammation and osteogenesis (PubMed:20498072, PubMed:22082366, PubMed:21820310, PubMed:22073225, PubMed:22331129). Plays an important role in favoring adipogenesis over osteoblastogenesis and acts as a key regulator of the adipogenesis/osteogenesis balance (PubMed:20498072, PubMed:22082366). Promotes adipogenesis by activating PPARG transcriptional activity in a deadenylase-independent manner by facilitating its nuclear translocation (PubMed:20498072). Regulates circadian expression of NOS2 in the liver and negatively regulates the circadian expression of IGF1 in the bone (PubMed:22073225, PubMed:20685873). Critical for proper development of early embryos (PubMed:23449310).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.