Snurf (NM_033174) Mouse Untagged Clone

CAT#: MC207787

Snurf (untagged) - Mouse SNRPN upstream reading frame (Snurf), (10ug)


  "NM_033174" in other vectors (3)

Reconstitution Protocol

USD 165.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Snurf"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Snurf
Synonyms 2410045I01Rik; Snrpn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207787 representing NM_033174
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGAGGAAGGGATCGCTTACACTTGAGAAGAACTACTGAACAGCACGTGCCCGAGGTCGAGGTCC
AGGTCAAACGTCGAAGGACAGCCTCACTGAGCAACCAAGAGTGTCACTTGTACCCACGACGTTCTCAGCA
ACAGCAAGTTCCTGTGGTGGATTTCCAGGCAGAACTAAGACAGGCATTCTTAGCTGAGACACCAAGAGGT
GGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_033174
Insert Size 216 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033174.3, NP_149409.1
RefSeq Size 1971 bp
RefSeq ORF 216 bp
Locus ID 84704
UniProt ID Q9WU12
Cytogenetics 7 B5
Gene Summary This gene is located within the mouse orthologous Prader-Willi Syndrome critical region and is imprinted and expressed from the paternal allele. This transcipt is thought to be bicistronic and can encode the small nuclear ribonucleoprotein polypeptide N (Snrpn) from a downstream open reading frame. The small protein represented by this gene is encoded by an evolutionarily-conserved upstream open reading frame and is localized to the nucleus. [provided by RefSeq, Mar 2017]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.