Nr2c2ap (NM_001025586) Mouse Untagged Clone

CAT#: MC207755

Nr2c2ap (untagged) - Mouse nuclear receptor 2C2-associated protein (Nr2c2ap), transcript variant 1, (10ug)

USD 402.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nr2c2ap (NM_001025586) Mouse Untagged Clone
Symbol Nr2c2ap
Synonyms 2310073E15Rik
Vector pCMV6-Entry
Sequence Data
>MC207755 representing NM_001025586
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTCAGTCTTTGGTTTGTCCGGACACTGTGAGCAGGGTCAGTTCTGTGCTCAATCGCAACAGCCGGC
AATTTGGAAAGAAACATCTTTTTGACCAGGATGAAGAGACGTGCTGGAACTCTGACCAGGGCCCCTCCCA
GTGGGTGTCACTCGAGTTTCCCCAGTGTGTTCAGATCACACAGCTGCAGGTGCAGTTCCAGGGTGGCTTC
TCCAGTCGCCACAGCTGCCTGGAAGGTTCACGGGGTGGGGAGGCACTCAGCAAGATTGTAGATTTCTACC
CTGAGGACACCAATGCCCTTCAGACCTTCTCCATCCCCACAATGGAGGTGGACCGACTGAAGTTGACTTT
TGAGGACACCACCGACTTTTTTGGCCGTGTAGTCATCTACCACCTGCGGGTGCTGGGTGAGAAGGCAGGG
TGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001025586
ORF Size 423 bp
Insert Size 423
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001025586.2, NP_001020757
RefSeq Size 1202
RefSeq ORF 423
Locus ID 75692
Cytogenetics 8|8 B3.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.