Rplp2 (NM_026020) Mouse Untagged Clone
CAT#: MC207613
Rplp2 (untagged) - Mouse ribosomal protein, large P2 (Rplp2), (10ug)
"NM_026020" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Rplp2 |
Synonyms | 2700049I22Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC207613 representing NM_026020
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGCTACGTCGCCTCTTACCTGCTGGCCGCCCTCGGGGGCAACTCCTCTCCTAGCGCCAAAGACATCA AGAAAATACTAGACAGCGTGGGCATCGAAGCGGACGATGATCGGCTCAACAAGGTCATCAGTGAGCTGAA TGGAAAGAACATTGAGGATGTCATCGCTCAGGGTGTTGGCAAGCTGGCCAGTGTGCCTGCTGGTGGGGCT GTGGCTGTTTCTGCTGCCCCTGGCTCTGCAGCACCTGCTGCTGGTTCTGCCCCCGCTGCAGCAGAGGAGA AGAAAGATGAGAAGAAGGAGGAGTCCGAGGAGTCGGATGACGACATGGGATTTGGCTTGTTTGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_026020 |
Insert Size | 348 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_026020.6, NP_080296.3 |
RefSeq Size | 441 bp |
RefSeq ORF | 348 bp |
Locus ID | 67186 |
UniProt ID | P99027 |
Cytogenetics | 7 F5 |
Gene Summary | Plays an important role in the elongation step of protein synthesis.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200483 | Rplp2 (Myc-DDK-tagged) - Mouse ribosomal protein, large P2 (Rplp2) |
USD 150.00 |
|
MR200483L3 | Lenti ORF clone of Rplp2 (Myc-DDK-tagged) - Mouse ribosomal protein, large P2 (Rplp2) |
USD 450.00 |
|
MR200483L4 | Lenti ORF clone of Rplp2 (mGFP-tagged) - Mouse ribosomal protein, large P2 (Rplp2) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review