Selenoi (NM_027652) Mouse Untagged Clone

CAT#: MC207477

Ept1 (untagged) - Mouse ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (Ept1), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)


  "NM_027652" in other vectors (2)

Reconstitution Protocol

USD 473.00

3 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Selenoi"

Specifications

Product Data
Type Mouse Untagged Clone
Symbol Selenoi
Synonyms 4933402G07Rik; AI448296; AI452230; C79563; D5Wsu178; D5Wsu178e; Ept; Ept1; mKIAA1724; SELI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207477 representing NM_027652
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGGCTACGAATACGTGAGCCCAGAGCAGCTGTCGGGCTTTGACAAGTACAAGTACAGCGCTTTGG
ATACCAACCCACTCTCTCTGTATATCATGCATCCATTTTGGAACACTATAGTGAAGGTGTTTCCTACTTG
GCTGGCTCCCAATCTTATAACCTTTTCTGGCTTTATGCTGCTTGTGTTCAATTTCCTACTCCTGACATAC
TTCGACCCTGACTTCTATGCTTCAGCCCCTGGTCATAAGCATGTGCCTGACTGGGTTTGGATTGTCGTGG
GCATCCTCAACTTTGCTGCCTACACTCTAGATGGAGTGGATGGAAAGCAAGCACGGAGAACCAATTCCAG
CACCCCGTTAGGGGAGCTGTTTGACCATGGCCTGGACAGTTGGTCGTGTGTTTACTTTGTTGTGACTGTG
TACTCCATCTTTGGACGAGGACCGACTGGCGTCAGTGTTTTTGTTCTTTATCTCCTGCTATGGGTAGTTT
TGTTTTCTTTTATCCTGTCTCACTGGGAGAAGTATAACACAGGCGTTCTTTTCCTGCCATGGGGATATGA
CATTAGCCAAGTGACTATTTCTTTTGTCTACATAGTGACTGCGGTTGTGGGAGTTGAGGCCTGGTATGAA
CCTTTCCTGTTTAATTTCTTATATAGAGACCTATTCACTGCAATGATTATTGGGTGTGCATTATGTGTGA
CTCTTCCAATGAGTTTATTAAACTTTTTTAGAAGCTATAAAAGCAACACGCTGAAGCACAAGTCCGTCTA
TGAAGCCATGGTCCCCTTCTTCTCTCCGTGTTTGCTCTTCACTTTGTGTACAGTGTGGATCCTCTGGTCA
CCTTCAGATATCTTAGAAATACACCCTAGAATATTCTACTTCATGGTTGGAACAGCTTTTGCCAATATCA
CATGTCAGCTAATTGTTTGCCAAATGAGCAGCACGCGGTGCCCGACTTTGAACTGGTTACTGCTTCCTCT
CCTCTTGGTTGTGGCAGCGGTGATCGTAGGTGCAGCCACCTCCCGCCTTGAGAGCGCCCTCCTTTACACA
CTCACGGCTGCCTTCACTCTGGCTCACATCCATTATGGCGTACAAGTGGTGAAGCAGCTGAGCCGACATT
TTCAGATTTATCCTTTTTCATTGAGGAAACCAAACTCAGATTGACTAGGAATGGAAGAACAGAATATCGG
CCTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_027652
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_027652.3, NP_081928.2
RefSeq Size 6806 bp
RefSeq ORF 1197 bp
Locus ID 28042
UniProt ID Q80TA1
Cytogenetics 5 16.22 cM
Gene Summary The multi-pass transmembrane protein encoded by this gene belongs to the CDP-alcohol phosphatidyltransferase class-I family. It catalyzes the transfer of phosphoethanolamine from CDP-ethanolamine to diacylglycerol to produce phosphatidylethanolamine, which is involved in the formation and maintenance of vesicular membranes, regulation of lipid metabolism, and protein folding. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) represents the selenoprotein encoding transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.