Slc9a3r1 (NM_012030) Mouse Untagged Clone

CAT#: MC207466

Slc9a3r1 (untagged) - Mouse solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1 (Slc9a3r1), (10ug)


  "NM_012030" in other vectors (4)

Reconstitution Protocol

USD 503.00

5 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Slc9a3r1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Slc9a3r1
Synonyms EBP-50; NHE-RF; NHERF-1; NHERF1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207466 representing NM_012030
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCGCGGACGCAGCGGCCGGGGAGCCTCTGCCCCGGCTCTGCTGCCTGGAGAAGGGTCCAAATGGCT
ACGGCTTCCACCTGCACGGGGAGAAGGGCAAGGTGGGCCAGTTTATCCGTCTGGTAGAACCTGGCTCGCC
GGCCGAGAAGTCGGGGTTGTTGGCTGGAGACCGATTGGTGGAGGTGAACGGTGAGAATGTGGAGAAGGAG
ACGCATCAGCAGGTGGTGAGCCGCATCCGCGCAGCGCTGAACGCCGTGCGCCTGCTGGTGGTCGACCCGG
AGACCGACGAGCGTCTCAAGAAGCTGGGCGTCTCGATCCGGGAAGAGCTGCTGCGCCCCCAGGAGAAGTC
CGAACAAGCCGAGCCTCCAGCGGCCGCCGACACTCATGAGGCTGGGGACCAGAATGAGGCCGAAAAGAGC
CACTTGCGCGAGCTCCGGCCCCGGCTCTGCACCATGAAGAAAGGCCCCAATGGCTATGGCTTCAACCTGC
ACAGCGACAAGTCTAAGCCAGGCCAGTTCATCCGAGCAGTGGACCCAGACTCACCGGCGGAGGCGTCTGG
ACTCCGGGCCCAGGACCGAATTGTGGAGGTCAATGGTGTCTGCATGGAGGGCAAGCAGCACGGGGACGTG
GTGTCCGCCATCAAGGGTGGAGGTGATGAGGCCAAGCTGCTGGTGGTAGACAAGGAAACAGATGAGTTCT
TCAAGAAGTGCAAAGTGATCCCATCCCAGGAGCACCTGGATGGCCCCTTGCCTGAGCCCTTCAGCAATGG
AGAGATACAGAAGGAGAGCAGCCGTGAAGCCCTGGTGGAGCCAGCTTCAGAGAGCCCCAGGCCAGCCCTG
GCAAGATCTGCCTCCAGCGATACCAGTGAGGAGCTAAATTCCCAAGACAGCCCCAAGAGACAAGTTTCCA
CAGAGCCCTCATCTACCTCCTCCTCCTCCTCTGACCCCATCTTGGACCTCAACATCTCCTTGGCTGTGGC
TAAAGAGAGGGCCCACCAGAAGCGCAGTAGCAAGAGGGCCCCGCAGATGGACTGGAGCAAGAAAAATGAA
CTCTTCAGCAACCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012030
Insert Size 1068 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_012030.2, NP_036160.1
RefSeq Size 1922 bp
RefSeq ORF 1068 bp
Locus ID 26941
UniProt ID P70441
Cytogenetics 11 E2
Gene Summary Scaffold protein that connects plasma membrane proteins with members of the ezrin/moesin/radixin family and thereby helps to link them to the actin cytoskeleton and to regulate their surface expression. Necessary for recycling of internalized ADRB2. Was first known to play a role in the regulation of the activity and subcellular location of SLC9A3. Necessary for cAMP-mediated phosphorylation and inhibition of SLC9A3. May enhance Wnt signaling (By similarity). May participate in HTR4 targeting to microvilli. Involved in the regulation of phosphate reabsorption in the renal proximal tubules (By similarity). Involved in sperm capacitation. May participate in the regulation of the chloride and bicarbonate homeostasis in spermatozoa.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.