Dgcr6 (BC048503) Mouse Untagged Clone
CAT#: MC207052
Dgcr6 (untagged) - Mouse DiGeorge syndrome critical region gene 6 (cDNA clone MGC:58370 IMAGE:6770478), (10ug)
"BC048503" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Dgcr6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC048503
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCGGCCGCCGGGGATGAGGCGGCGGATCGGGTCCTACACCACGCTCAGCGACTTGGCCCTGGCGCTGC TCGACGGAACGGTGTTTGAAATCGTGCAGGGTCTTCTGGAGATTCAGCACCTCACTGAGAAGAGCCTCTA CAACCAGAGACTGCGGCTGCAGAACGAACACCGAGTGCTCAGACAGACTCTAAGGCAGAAGCACCTGGAA GCCCAGCAGTCCTGCCGGCCCCACAACTTGCCAGTGCTCCAGGCAGCTCAGCAGCGTGAGCTGGAGGCCA TGGAACATCGGATCCGGGAGGAGCAGCAGGCTATGGACCGAAAGATTGTCCTGGAGCTGGACCGGAAGGT TGCCGACCAGCAGAGCACACTGGAGAAGGCAGGGGTAGCTGGTTTCTACGTGACCACCAATCCTCAGGAG CTGACGCTGCAGATGAACCTATTGGAACTCATCAGGAAGCTGCAGCAGAGGGGCTGCCAAGTGGGAAAGG CAGCTCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC048503 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC048503, AAH48503 |
RefSeq Size | 948 bp |
RefSeq ORF | 500 bp |
Locus ID | 13353 |
Cytogenetics | 16 11.19 cM |
Gene Summary | This gene encodes a protein that is similar to the gonadal protein in Drosophila (fruit fly). The encoded protein is thought to play a role in migration of neural crest cells during development. Deletions in the human gene are associated with DiGeorge syndrome (or velocardiofacial syndrome) which has many clinical features including cardiac abnormalities, cleft palate, atypical facial features, hypocalcemia, hypoparathyroidism and defective development or congenital absence of the thymus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201357 | Dgcr6 (tGFP-tagged) - Mouse DiGeorge syndrome critical region gene 6 (cDNA clone MGC:58370 IMAGE:6770478) |
USD 365.00 |
|
MR201357 | Dgcr6 (Myc-DDK-tagged) - Mouse DiGeorge syndrome critical region gene 6 (cDNA clone MGC:58370 IMAGE:6770478) |
USD 165.00 |
|
MR201357L3 | Lenti ORF clone of Dgcr6 (Myc-DDK-tagged) - Mouse DiGeorge syndrome critical region gene 6 (cDNA clone MGC:58370 IMAGE:6770478) |
USD 465.00 |
|
MR201357L4 | Lenti ORF clone of Dgcr6 (mGFP-tagged) - Mouse DiGeorge syndrome critical region gene 6 (cDNA clone MGC:58370 IMAGE:6770478) |
USD 465.00 |
{0} Product Review(s)
Be the first one to submit a review