Tbpl1 (BC033926) Mouse Untagged Clone

CAT#: MC206994

Tbpl1 (untagged) - Mouse TATA box binding protein-like 1 (cDNA clone MGC:41136 IMAGE:1382180), (10ug)

USD 320.00


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tbpl1 (BC033926) Mouse Untagged Clone
Symbol Tbpl1
Synonyms 4732475G08, TLF, TRP, TRF2, STD
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>BC033926
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGCAGACAGTGATGTTGCATTGGACATTTTAATTACAAATGTAGTCTGTGTTTTTAGAACAAGAT
GCCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGATGTTGGGAAAGT
ATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGA
GCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCCCGTAGTCTGCAGAAACTAGGTTTTC
AGGTCATCTTCACAGATTTTAAGGTGGTGAATGTTTTGGCAGTGTGTAACATGCCCTTTGAGATCCGTTT
GCCAGAATTTACAAAGAACAATAGACCTCATGCCAGCTATGAACCTGAACTTCATCCTGCCGTGTGCTAT
CGGATAAAGTCTCTAAGAGCTACATTACAGATATTTTCAACAGGAAGCATCACAGTGACAGATCATGTAA
ATGATCGAGTTCCGTGGGCTAATTATTACTACATTGCATGGCCTCATCACCTGATGCCTGCCCCAGAATC
CTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN BC033926
ORF Size 567 bp
Insert Size 567
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC033926,
RefSeq Size 1338
RefSeq ORF 567
Locus ID 237336
Cytogenetics 10|10 A3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.