Btf3 (NM_001170540) Mouse Untagged Clone
CAT#: MC206980
Btf3 (untagged) - Mouse basic transcription factor 3 (Btf3), transcript variant 2, (10ug)
"NM_001170540" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Btf3 |
Synonyms | 1700054E11Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206980 representing NM_001170540.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAGAAACAATCATGAACCAGGAGAAACTCGCCAAACTGCAGGCACAAGTGCGCATTGGTGGGAAA GGAACTGCTCGTAGGAAGAAGAAGGTGGTTCACAGAACGGCCACAGCAGACGATAAGAAACTGCAGTTC TCCTTAAAGAAGTTAGGGGTGAACAACATCTCTGGTATTGAAGAGGTGAACATGTTTACAAACCAAGGA ACAGTGATCCATTTTAACAACCCTAAAGTTCAGGCATCCCTGGCAGCAAACACCTTCACCATTACAGGC CACGCTGAGACAAAGCAGCTGACAGAAATGCTTCCCAGCATCCTCAACCAGCTTGGTGCAGACAGCCTG ACTAGTTTAAGGAGACTGGCTGAAGCTCTGCCCAAACAATCTGTGGATGGAAAAGCACCCCTTGCTACT GGAGAGGATGATGATGATGAAGTTCCAGATCTGGTGGAGAATTTTGATGAGGCTTCTAAGAATGAGGCA AACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001170540 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001170540.1 |
RefSeq Size | 906 bp |
RefSeq ORF | 489 bp |
Locus ID | 218490 |
UniProt ID | Q64152 |
Cytogenetics | 13 D1 |
MW | 17.7 kDa |
Gene Summary | When associated with NACA, prevents inappropriate targeting of non-secretory polypeptides to the endoplasmic reticulum (ER). Binds to nascent polypeptide chains as they emerge from the ribosome and blocks their interaction with the signal recognition particle (SRP), which normally targets nascent secretory peptides to the ER. BTF3 is also a general transcription factor that can form a stable complex with RNA polymerase II. Required for the initiation of transcription (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded protein (isoform 2) is shorter when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201278 | Btf3 (Myc-DDK-tagged) - Mouse basic transcription factor 3 (Btf3), transcript variant 2 |
USD 150.00 |
|
MR201278L3 | Lenti ORF clone of Btf3 (Myc-DDK-tagged) - Mouse basic transcription factor 3 (Btf3), transcript variant 2 |
USD 450.00 |
|
MR201278L4 | Lenti ORF clone of Btf3 (mGFP-tagged) - Mouse basic transcription factor 3 (Btf3), transcript variant 2 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review